ID: 1132665644

View in Genome Browser
Species Human (GRCh38)
Location 16:1080266-1080288
Sequence CCCAGAGGGAAGGCCGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 168}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132665644_1132665660 25 Left 1132665644 16:1080266-1080288 CCCATGCCGGCCTTCCCTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 168
Right 1132665660 16:1080314-1080336 AGGCGAGAGGGTCTTCCTGACGG 0: 1
1: 0
2: 0
3: 12
4: 143
1132665644_1132665652 -4 Left 1132665644 16:1080266-1080288 CCCATGCCGGCCTTCCCTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 168
Right 1132665652 16:1080285-1080307 TGGGGAGCGACTTTTCCAGAAGG 0: 1
1: 0
2: 1
3: 7
4: 81
1132665644_1132665654 5 Left 1132665644 16:1080266-1080288 CCCATGCCGGCCTTCCCTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 168
Right 1132665654 16:1080294-1080316 ACTTTTCCAGAAGGCCGGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 109
1132665644_1132665661 28 Left 1132665644 16:1080266-1080288 CCCATGCCGGCCTTCCCTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 168
Right 1132665661 16:1080317-1080339 CGAGAGGGTCTTCCTGACGGCGG 0: 1
1: 0
2: 0
3: 12
4: 81
1132665644_1132665657 13 Left 1132665644 16:1080266-1080288 CCCATGCCGGCCTTCCCTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 168
Right 1132665657 16:1080302-1080324 AGAAGGCCGGCCAGGCGAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 371
1132665644_1132665656 12 Left 1132665644 16:1080266-1080288 CCCATGCCGGCCTTCCCTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 168
Right 1132665656 16:1080301-1080323 CAGAAGGCCGGCCAGGCGAGAGG 0: 1
1: 1
2: 0
3: 16
4: 171
1132665644_1132665653 0 Left 1132665644 16:1080266-1080288 CCCATGCCGGCCTTCCCTCTGGG 0: 1
1: 0
2: 2
3: 16
4: 168
Right 1132665653 16:1080289-1080311 GAGCGACTTTTCCAGAAGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132665644 Original CRISPR CCCAGAGGGAAGGCCGGCAT GGG (reversed) Intergenic
900210056 1:1450950-1450972 CCGAGAGGGAGGGCCGGTGTTGG + Intronic
900534692 1:3171014-3171036 CCCTAAGGGAAGGCTGGGATAGG + Intronic
900551562 1:3259074-3259096 GCCAGAAGGAAGGCCTGGATTGG + Intronic
900752148 1:4405296-4405318 CCCGGAGGGAAGGCGGCCAGGGG - Intergenic
901034740 1:6329632-6329654 CCCAGATGGAAAGGCAGCATTGG - Intronic
902747519 1:18483363-18483385 CCCAGAGGGACGGCTGGCAGTGG - Exonic
902931487 1:19734678-19734700 TCCAGAGGGTCGGCCAGCATGGG - Intronic
903509686 1:23865868-23865890 CCCAGAGGGAAGGAAGGAGTGGG + Intronic
904352910 1:29920536-29920558 CCCGTAGGGAAGGCCAGCGTGGG - Intergenic
905647291 1:39633317-39633339 CGCAGAGGGAAGGCCCGGAGTGG - Intronic
911172252 1:94782302-94782324 CACAGAGGGAAGGCAGACAAAGG + Intergenic
915344127 1:155190309-155190331 CCCAGAGAGCAGGCCGGCCCCGG - Intronic
915367267 1:155323353-155323375 CGCAGAGGGAAGGAGGGCAGCGG - Intronic
916536299 1:165706768-165706790 CCCAGAGGGAAGGTTGGGAGAGG + Intergenic
920982588 1:210852241-210852263 CCCAGAGGGAAGGAGGGGCTTGG + Intronic
921369030 1:214402867-214402889 CCCACAGGTAAGGCAGGCAGAGG - Exonic
922033834 1:221829177-221829199 CACAGAGGGAAGGTAGGCTTTGG - Intergenic
923342491 1:233019648-233019670 CTCAGAGGGGAGGCAGGCAGTGG + Intronic
1064437016 10:15319372-15319394 CTCAGAGGGAAGGATGGGATGGG + Intronic
1066065140 10:31756341-31756363 CCCAGAAGGAAGGAGGGCAAGGG + Intergenic
1067828626 10:49597348-49597370 CCCAGAGGGAGGGCAGGAAAGGG - Intergenic
1069494852 10:68894401-68894423 TCCAGAGAGAAGCCCGGCACTGG + Intronic
1070724762 10:78780381-78780403 CCCAGAGGCTGGGCCAGCATGGG + Intergenic
1070745629 10:78931993-78932015 CCCAGTGAGAAAGCCAGCATGGG + Intergenic
1070754805 10:78985449-78985471 CCCAGGGGAAAGGCAGGCCTGGG - Intergenic
1071343387 10:84668335-84668357 TCCAGAGGGAAGGCAGGCTGGGG - Intergenic
1072615089 10:97043768-97043790 CACGGAGGCAAGGCCAGCATGGG - Intronic
1076885710 10:133261537-133261559 CCCAGAGGGAACGTGCGCATCGG + Intergenic
1077402704 11:2367055-2367077 TCCAGAGGGAAGGCCAGGTTGGG - Intergenic
1077707072 11:4497188-4497210 GCCACAGGGAAGGCAGGTATTGG + Intergenic
1078095853 11:8296681-8296703 TCCTGAGGGAAGGCCAGCTTTGG + Intergenic
1079090021 11:17474392-17474414 CCCAAACGGAAGGTGGGCATGGG + Intronic
1079214374 11:18494834-18494856 GCCAGAGGGAAGAACAGCATTGG + Intronic
1080892575 11:36422232-36422254 CCCAGAGGGAAGGCTTGTAGAGG + Intronic
1081574544 11:44310837-44310859 GCCAGCGGGAAGGCCCGCAGCGG - Intergenic
1084734397 11:71094969-71094991 CTCAGAGGGAAGGGCAGCAAGGG - Intronic
1084937030 11:72592347-72592369 CCCAGAGCTGAGGCAGGCATTGG - Intronic
1089700435 11:120240946-120240968 CCCTTAGGGAAGGAAGGCATGGG - Intronic
1091350891 11:134893136-134893158 CCCTGAGGAAATGCCTGCATTGG - Intergenic
1091702918 12:2675949-2675971 GCCAGAGGGAAAGCCGGATTTGG + Intronic
1100464535 12:94833633-94833655 CCCAGAGAGAACGCCGCCGTGGG + Intergenic
1100883063 12:99039634-99039656 GCCAGAGGGAAGGCAGGCTTGGG - Intronic
1101071754 12:101082633-101082655 CCCTGAGGGAAGTCCAGCCTTGG + Intronic
1104041450 12:125133881-125133903 CCCAGAGGCAGGTCTGGCATGGG - Intronic
1104970344 12:132528091-132528113 TCCAGAGGGAAAGCGGGCACGGG - Intronic
1104984245 12:132587652-132587674 CCCAGAGGGACTGCCTGGATGGG - Intergenic
1107018830 13:35731130-35731152 CCCTGAGGGAAGGAAGGCTTCGG - Intergenic
1112882057 13:104120261-104120283 CCAAGAGTGAACGCAGGCATGGG + Intergenic
1113723845 13:112582539-112582561 CCCACAGGGAAGGGCGGCACTGG + Intronic
1117225416 14:53653591-53653613 CCCAGAAGGAAGGCAGGAAAAGG + Intergenic
1119266177 14:73264377-73264399 CCGAGTGGGAAGGCCAGGATGGG + Intronic
1119385977 14:74258404-74258426 CCCGGAGGGAAGGGCGGCGCCGG + Intronic
1119432560 14:74578051-74578073 CCCAGAGGGGAGGGTGGCAGCGG + Intronic
1121107878 14:91292955-91292977 CCCAGAGAGAAGGCTGGAAAAGG - Intronic
1121732706 14:96197635-96197657 CTCAGAGGGAACGCGGGCTTCGG + Intergenic
1122008567 14:98726930-98726952 CAGAGAGGCAAGGCGGGCATTGG + Intergenic
1122378545 14:101285719-101285741 CCAGGAGAGAAGGGCGGCATCGG + Intergenic
1123489129 15:20765723-20765745 CACAGAGGGAAGAAAGGCATTGG + Intergenic
1123545628 15:21334810-21334832 CACAGAGGGAAGAAAGGCATTGG + Intergenic
1128244791 15:66125869-66125891 CCCAGAGAGAAGCCCAGCAGAGG + Intronic
1128515393 15:68338863-68338885 GCCAGAGGGGAGGGCGGCAAGGG - Intronic
1132233249 15:100200402-100200424 CCCAGAAGTGCGGCCGGCATGGG - Intronic
1202953970 15_KI270727v1_random:62080-62102 CACAGAGGGAAGAAAGGCATTGG + Intergenic
1132634778 16:938363-938385 CTCACAGGGAAGGCAGGGATGGG + Intronic
1132665644 16:1080266-1080288 CCCAGAGGGAAGGCCGGCATGGG - Intergenic
1133285989 16:4691087-4691109 CCCAGAGGGAAGCCAGGCAGAGG - Intergenic
1133777541 16:8909268-8909290 GCCAGAAGGAAGGTCTGCATTGG - Intronic
1134523429 16:14928578-14928600 GGCAGAGGAAAGGGCGGCATGGG - Intronic
1134711023 16:16327062-16327084 GGCAGAGGAAAGGGCGGCATGGG - Intergenic
1134948560 16:18341547-18341569 GGCAGAGGAAAGGGCGGCATGGG + Intergenic
1137417184 16:48293783-48293805 GACAGAGGGAAGGCTGACATTGG + Intronic
1137705601 16:50533709-50533731 CCCAGAGGCAAGGGCTTCATGGG + Intergenic
1139189002 16:64840003-64840025 CCCAGAGGGAAGGCCACTGTAGG - Intergenic
1139480006 16:67225555-67225577 CCCAGGGAAAAGGCCCGCATAGG - Intronic
1139750779 16:69107649-69107671 CCCAGAGCGCAGGCAGGCAGGGG + Exonic
1141765943 16:86060152-86060174 TCCTGAGGGAAGGCCGGCTCTGG - Intergenic
1141886685 16:86897049-86897071 CCCAGGGGTCAGGCCGACATGGG - Intergenic
1143586103 17:7851300-7851322 GCCAGAGGGTAGGCAGGCCTGGG - Intronic
1143904787 17:10199365-10199387 TGCAGAGGGAAGGCCGGCCCAGG + Intergenic
1145066030 17:19761996-19762018 CACAGAGGGAAGGTAGGCAAAGG + Intergenic
1147331690 17:39703117-39703139 CCCAAAAGGAAGACAGGCATTGG - Intronic
1148046443 17:44747876-44747898 CCCAGAAAGAAGGACTGCATGGG + Intronic
1151705614 17:75765367-75765389 TCCAGAGGGAAGGACACCATCGG - Exonic
1152198750 17:78933166-78933188 CCCAAAGGGAAGGCCGGGCGTGG - Intergenic
1152587869 17:81197125-81197147 CCCAGAGGGCAGGGCCGCAGGGG - Intronic
1155454012 18:25991654-25991676 CCCAGAGGGCAGGAATGCATGGG + Intergenic
1159011448 18:63062450-63062472 CACAGAGGGAAGGCAGCCGTGGG + Intergenic
1160111262 18:76033994-76034016 CACAGAGGGAAGACGGCCATGGG + Intergenic
1160158938 18:76456474-76456496 CCCAGAAGGCTGGCCGGGATAGG - Intronic
1160731313 19:642844-642866 CCCAGAGGGACGGACGTCAGGGG - Intronic
1161587122 19:5111533-5111555 CCCAGAGTGAAGGCGAGCACCGG + Intronic
1161614252 19:5261156-5261178 CCCAGAGGGAAGGCCACCAAAGG - Intronic
1162752915 19:12839679-12839701 CCCAGACGGAAGGACAGTATCGG + Intronic
1165068880 19:33243807-33243829 GGCAGAGGGAAGGGCGGCAGAGG + Intergenic
1165215196 19:34266223-34266245 CCCAGAGAGCAGGCCCGCAGTGG - Intronic
1166078043 19:40425449-40425471 CCCCGGGGGAAAGCCGGCCTGGG - Intronic
1166113875 19:40640852-40640874 CCCAGAGAGAAGGCAGGCTGTGG + Intergenic
926160710 2:10487528-10487550 CAGAGAGGGAAGCCAGGCATCGG - Intergenic
927462190 2:23308964-23308986 CCCAGAGGAAATGCAGGCCTGGG - Intergenic
927572892 2:24175251-24175273 CCCGGAGGAAAGGCCCGCTTTGG + Intronic
927996848 2:27492896-27492918 CCCAGAGAGGAGGACTGCATGGG - Intronic
928660938 2:33501073-33501095 CACTGAGGGAAGGCAGGAATGGG - Intronic
931220226 2:60282724-60282746 CTAAGAGGGAAGGCAGGCAGAGG + Intergenic
932316954 2:70790761-70790783 TCCAGAGAGGAGGCCGGGATTGG - Intergenic
932405779 2:71511951-71511973 CCCAGCAAGAAGGCCGGCAGTGG + Intronic
936396513 2:112135959-112135981 CTTAGAGGGAAGGCAGCCATAGG + Intergenic
937924129 2:127154562-127154584 CTCAGTGGGAACCCCGGCATAGG + Intergenic
939459587 2:142482401-142482423 CACAGGGAGAAGGCCGCCATGGG + Intergenic
942555197 2:177165780-177165802 CCCAGAGGAAATGAGGGCATGGG - Intergenic
945988233 2:216371671-216371693 ACCAGAGGCGAGGCCGGCGTGGG + Exonic
1169334661 20:4746347-4746369 CCCAGAGGGAAGAGAGGAATTGG + Intergenic
1170951252 20:20938277-20938299 CGCAGAGAGAAGGCCGTCATGGG - Intergenic
1175187511 20:57188974-57188996 CCCAGACGGAAGGGAGGCCTTGG - Intronic
1175242648 20:57561104-57561126 CCCAGTGGGAAGGCCGTGCTTGG - Exonic
1175315468 20:58043874-58043896 AGGAGAGGGAAGGCTGGCATGGG + Intergenic
1175391804 20:58632234-58632256 CCCAGAAGAGAGGCCAGCATGGG - Intergenic
1176044199 20:63083967-63083989 CCCAGAGGGCAGGACGGGAGCGG + Intergenic
1179903178 21:44405683-44405705 CCCACAGGGCAGCCTGGCATGGG - Intronic
1180187624 21:46147258-46147280 CCCAAAGGGAAGGCAGGGACTGG - Intronic
1180876352 22:19176949-19176971 CCCTGCGGGAAGGCAGGCACGGG + Exonic
1182262644 22:29085996-29086018 CTCAGAGGGAAGGCCCACATGGG + Intronic
1183617850 22:38956020-38956042 CAGAGAGGGGAGGCAGGCATGGG + Intronic
949939143 3:9140939-9140961 CCCAGGGGTTAGGCAGGCATAGG + Intronic
950501908 3:13369900-13369922 CACAGAGGGGAGGCCAGCCTGGG + Intronic
952919636 3:38275811-38275833 CCCAGAGGGAGAGCCTGCCTTGG - Intronic
954107960 3:48419437-48419459 TCCAGAGGCAAGGCCGGTGTGGG + Intronic
957913333 3:86652260-86652282 CCCAGAAGGAAGGGCAGAATGGG - Intergenic
962650069 3:137479521-137479543 ATCAGAGGGAAGGATGGCATGGG + Intergenic
966914225 3:184576012-184576034 CCCAGAGGGAAGGCCTGCAGAGG - Intronic
969716656 4:8871289-8871311 CCCAGAGCGAAGGGCGGCCCGGG + Exonic
971443821 4:26720416-26720438 CCCAAAAGGAAGGTCTGCATTGG - Intronic
973606636 4:52593602-52593624 CCCAGAAGGAGGGCAGGCACAGG - Exonic
974010745 4:56604996-56605018 CTCAGAGGGAAGGCTGGTAGGGG + Intergenic
977344981 4:95806520-95806542 CTCAGAGGGAGCGACGGCATTGG + Intergenic
982341804 4:154307865-154307887 CCCAGAGAGAAAGGAGGCATTGG + Intronic
984548967 4:181138339-181138361 ACCAGTGGGAAGCCCGGCCTTGG + Intergenic
984845092 4:184101956-184101978 CCCAGAGAGAATGCAGGCACCGG - Intronic
985142119 4:186851549-186851571 CCTAGAGGGAAAGCCGGCATTGG + Intergenic
986572897 5:9183311-9183333 CCCAGAGGGATGTCGGGTATGGG - Intronic
987322544 5:16784100-16784122 TCCAGAGGGAAGGGAGGCAAAGG + Intronic
988882406 5:35517426-35517448 TCCAGAGGGGAGGACTGCATTGG + Intergenic
993904297 5:93605641-93605663 CACGGAGGTAAGGCCGCCATAGG + Intergenic
994224147 5:97232580-97232602 CCCAGATGGAAGGGAGCCATGGG - Intergenic
995445457 5:112237767-112237789 CCCAGAGGTTAGGCAGGGATGGG - Intronic
997738778 5:136235455-136235477 CTCAGAGAGAAGGCTAGCATTGG + Intronic
1001527424 5:172438605-172438627 CACAGAGGGAATGCAGGCATGGG + Intronic
1002374022 5:178775436-178775458 CCCAGAGGCAGGCCTGGCATGGG + Intergenic
1002954511 6:1848684-1848706 TCCAGAGGGCAGGACTGCATAGG + Intronic
1006470673 6:34227027-34227049 CTCAGAGGGAAGGCAGGAGTTGG + Intergenic
1009866752 6:69407381-69407403 CTCAGAGCAAAGGCCTGCATGGG + Intergenic
1013680666 6:112521935-112521957 CCCAGAGGAAAAGGCAGCATTGG - Intergenic
1019427873 7:985883-985905 CCCAGAGGCAGGGCCGTGATGGG + Intronic
1019731261 7:2630828-2630850 CCCAGAGGGAAGGCCGGATGGGG + Intergenic
1020256705 7:6506446-6506468 CCCAAAGGGAGGGCAGGCAGGGG + Intronic
1021912134 7:25396822-25396844 CCCAGAGGCAGGGCCTGCATGGG + Intergenic
1023220912 7:37919584-37919606 GCCAGAGGGAAGGCAGGGAGAGG - Intronic
1026473388 7:70713200-70713222 CACAGATGGCAGGCCGGCATTGG - Intronic
1029415079 7:100437278-100437300 CCCAGAAGGGAGTCCGGGATGGG - Intergenic
1029641046 7:101819371-101819393 CCCAAAGGGAAGGCAGTCATTGG - Intronic
1029987552 7:104935845-104935867 CCCAGAAGGAATGCCGGCTCAGG - Intergenic
1032784536 7:135190109-135190131 CCCATAGTGAAAGCCGGCTTTGG - Intronic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1034313592 7:150110782-150110804 GGCAGAGGCAAGGCCGGCAGGGG + Intergenic
1034391151 7:150788566-150788588 CCCAGAGGGAAGGCCACCTGAGG - Intergenic
1034451658 7:151140127-151140149 CCCAGAGGGAAACCGGGCACAGG + Intronic
1034495175 7:151416556-151416578 CACAGAGGGAGGTCCGGAATTGG + Intergenic
1034793304 7:153990014-153990036 GGCAGAGGCAAGGCCGGCAGGGG - Intronic
1034871622 7:154690314-154690336 TCCTAAGGGAAGGCCGACATTGG - Intronic
1035114583 7:156514059-156514081 CCCAGAGGGAAGCCAGTCATGGG + Intergenic
1039079824 8:33723092-33723114 GCCAGAGGGAAGGCCGGGCAGGG + Intergenic
1042043792 8:64624892-64624914 CCCAGGGGGAAGGGTGGGATGGG - Intronic
1042215789 8:66428945-66428967 ACCAGAGGAAAGGCCGGCAGAGG - Intergenic
1049348730 8:142152801-142152823 CCCAGAGGCATGGCCAGCACCGG + Intergenic
1049391391 8:142373396-142373418 CCCACAGGGAAGGCCAGCAGCGG + Intronic
1049721264 8:144116519-144116541 CCCGGAGGGGTGGCCGGCCTAGG + Exonic
1056381530 9:86061529-86061551 AGCAGAGGGAAGACCGGGATGGG + Intronic
1056449707 9:86705010-86705032 CCCAGAGGGAAGGAAGTCACAGG - Intergenic
1057313255 9:93954536-93954558 CGCAGAGGGATGGCCGGGAGTGG - Intronic
1061618190 9:131793898-131793920 CCCAGAGGGAGGGCAGGGAGAGG + Intergenic
1062047102 9:134429406-134429428 CCCAGAGGCAGGGCTGGCACAGG - Intronic
1185757685 X:2664912-2664934 CCCAGAGGGAAGGCCTTCACTGG + Intergenic
1186618635 X:11215009-11215031 CCCTGAGGGCAGGCCGGGGTGGG + Intronic
1189214354 X:39310513-39310535 CAAGGAGGGAAGGCAGGCATTGG + Intergenic
1189260906 X:39678219-39678241 CCCAGCGGGAGGGCAGGCTTAGG + Intergenic
1190370862 X:49739493-49739515 CCCAGGAGGAAGGCTGGCCTTGG + Intergenic
1199690100 X:150303072-150303094 CCAAGAGGGGATGCTGGCATTGG - Intergenic
1199708607 X:150451956-150451978 TCCAGAGGCAGGGCTGGCATAGG + Intronic