ID: 1132665674

View in Genome Browser
Species Human (GRCh38)
Location 16:1080381-1080403
Sequence AGCCTTGGACGGGGACCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132665674_1132665683 25 Left 1132665674 16:1080381-1080403 CCACCGGGTCCCCGTCCAAGGCT No data
Right 1132665683 16:1080429-1080451 AAGCGCTTGACTCAGGTCCCCGG No data
1132665674_1132665680 18 Left 1132665674 16:1080381-1080403 CCACCGGGTCCCCGTCCAAGGCT No data
Right 1132665680 16:1080422-1080444 CACCCGAAAGCGCTTGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132665674 Original CRISPR AGCCTTGGACGGGGACCCGG TGG (reversed) Intergenic
No off target data available for this crispr