ID: 1132665680

View in Genome Browser
Species Human (GRCh38)
Location 16:1080422-1080444
Sequence CACCCGAAAGCGCTTGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132665677_1132665680 8 Left 1132665677 16:1080391-1080413 CCCGTCCAAGGCTGCTCTGCTAA No data
Right 1132665680 16:1080422-1080444 CACCCGAAAGCGCTTGACTCAGG No data
1132665675_1132665680 15 Left 1132665675 16:1080384-1080406 CCGGGTCCCCGTCCAAGGCTGCT No data
Right 1132665680 16:1080422-1080444 CACCCGAAAGCGCTTGACTCAGG No data
1132665672_1132665680 23 Left 1132665672 16:1080376-1080398 CCGAGCCACCGGGTCCCCGTCCA No data
Right 1132665680 16:1080422-1080444 CACCCGAAAGCGCTTGACTCAGG No data
1132665679_1132665680 3 Left 1132665679 16:1080396-1080418 CCAAGGCTGCTCTGCTAAGTTAA No data
Right 1132665680 16:1080422-1080444 CACCCGAAAGCGCTTGACTCAGG No data
1132665678_1132665680 7 Left 1132665678 16:1080392-1080414 CCGTCCAAGGCTGCTCTGCTAAG No data
Right 1132665680 16:1080422-1080444 CACCCGAAAGCGCTTGACTCAGG No data
1132665674_1132665680 18 Left 1132665674 16:1080381-1080403 CCACCGGGTCCCCGTCCAAGGCT No data
Right 1132665680 16:1080422-1080444 CACCCGAAAGCGCTTGACTCAGG No data
1132665676_1132665680 9 Left 1132665676 16:1080390-1080412 CCCCGTCCAAGGCTGCTCTGCTA No data
Right 1132665680 16:1080422-1080444 CACCCGAAAGCGCTTGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132665680 Original CRISPR CACCCGAAAGCGCTTGACTC AGG Intergenic
No off target data available for this crispr