ID: 1132665918

View in Genome Browser
Species Human (GRCh38)
Location 16:1081270-1081292
Sequence CTGGGCAGACGGCGGGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132665918_1132665930 9 Left 1132665918 16:1081270-1081292 CCGTGCTCCCGCCGTCTGCCCAG No data
Right 1132665930 16:1081302-1081324 TCAACCTCCTGGAGGGCACAGGG No data
1132665918_1132665934 22 Left 1132665918 16:1081270-1081292 CCGTGCTCCCGCCGTCTGCCCAG No data
Right 1132665934 16:1081315-1081337 GGGCACAGGGAGCGGCTGAGTGG No data
1132665918_1132665932 14 Left 1132665918 16:1081270-1081292 CCGTGCTCCCGCCGTCTGCCCAG No data
Right 1132665932 16:1081307-1081329 CTCCTGGAGGGCACAGGGAGCGG No data
1132665918_1132665929 8 Left 1132665918 16:1081270-1081292 CCGTGCTCCCGCCGTCTGCCCAG No data
Right 1132665929 16:1081301-1081323 CTCAACCTCCTGGAGGGCACAGG No data
1132665918_1132665935 23 Left 1132665918 16:1081270-1081292 CCGTGCTCCCGCCGTCTGCCCAG No data
Right 1132665935 16:1081316-1081338 GGCACAGGGAGCGGCTGAGTGGG No data
1132665918_1132665926 1 Left 1132665918 16:1081270-1081292 CCGTGCTCCCGCCGTCTGCCCAG No data
Right 1132665926 16:1081294-1081316 GCAGGACCTCAACCTCCTGGAGG No data
1132665918_1132665925 -2 Left 1132665918 16:1081270-1081292 CCGTGCTCCCGCCGTCTGCCCAG No data
Right 1132665925 16:1081291-1081313 AGAGCAGGACCTCAACCTCCTGG No data
1132665918_1132665927 2 Left 1132665918 16:1081270-1081292 CCGTGCTCCCGCCGTCTGCCCAG No data
Right 1132665927 16:1081295-1081317 CAGGACCTCAACCTCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132665918 Original CRISPR CTGGGCAGACGGCGGGAGCA CGG (reversed) Intergenic
No off target data available for this crispr