ID: 1132666322

View in Genome Browser
Species Human (GRCh38)
Location 16:1082840-1082862
Sequence CGGGGTCTGATGGCCTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132666312_1132666322 8 Left 1132666312 16:1082809-1082831 CCTGCTTGGAGCACGTGGGAGGA No data
Right 1132666322 16:1082840-1082862 CGGGGTCTGATGGCCTCAGTGGG No data
1132666308_1132666322 19 Left 1132666308 16:1082798-1082820 CCTGGCTGGTTCCTGCTTGGAGC No data
Right 1132666322 16:1082840-1082862 CGGGGTCTGATGGCCTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132666322 Original CRISPR CGGGGTCTGATGGCCTCAGT GGG Intergenic
No off target data available for this crispr