ID: 1132666494

View in Genome Browser
Species Human (GRCh38)
Location 16:1083425-1083447
Sequence CCCCATCAGCAGGGGTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132666484_1132666494 -6 Left 1132666484 16:1083408-1083430 CCCTCATCCCAACCCAGCCCCAT No data
Right 1132666494 16:1083425-1083447 CCCCATCAGCAGGGGTGCCCTGG No data
1132666483_1132666494 -2 Left 1132666483 16:1083404-1083426 CCGACCCTCATCCCAACCCAGCC No data
Right 1132666494 16:1083425-1083447 CCCCATCAGCAGGGGTGCCCTGG No data
1132666485_1132666494 -7 Left 1132666485 16:1083409-1083431 CCTCATCCCAACCCAGCCCCATC No data
Right 1132666494 16:1083425-1083447 CCCCATCAGCAGGGGTGCCCTGG No data
1132666482_1132666494 6 Left 1132666482 16:1083396-1083418 CCAGCGGGCCGACCCTCATCCCA No data
Right 1132666494 16:1083425-1083447 CCCCATCAGCAGGGGTGCCCTGG No data
1132666480_1132666494 8 Left 1132666480 16:1083394-1083416 CCCCAGCGGGCCGACCCTCATCC No data
Right 1132666494 16:1083425-1083447 CCCCATCAGCAGGGGTGCCCTGG No data
1132666477_1132666494 28 Left 1132666477 16:1083374-1083396 CCGTCGTGGATGCTGACAGACCC No data
Right 1132666494 16:1083425-1083447 CCCCATCAGCAGGGGTGCCCTGG No data
1132666481_1132666494 7 Left 1132666481 16:1083395-1083417 CCCAGCGGGCCGACCCTCATCCC No data
Right 1132666494 16:1083425-1083447 CCCCATCAGCAGGGGTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132666494 Original CRISPR CCCCATCAGCAGGGGTGCCC TGG Intergenic
No off target data available for this crispr