ID: 1132667108

View in Genome Browser
Species Human (GRCh38)
Location 16:1086546-1086568
Sequence TAGCCAGAAGGTAGCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132667108_1132667111 5 Left 1132667108 16:1086546-1086568 CCACAGCAGCTACCTTCTGGCTA No data
Right 1132667111 16:1086574-1086596 AGTAATGCTGCTGTGAACATGGG 0: 10
1: 170
2: 832
3: 1949
4: 3131
1132667108_1132667112 29 Left 1132667108 16:1086546-1086568 CCACAGCAGCTACCTTCTGGCTA No data
Right 1132667112 16:1086598-1086620 GTACATCCCACAATCCCACATGG No data
1132667108_1132667110 4 Left 1132667108 16:1086546-1086568 CCACAGCAGCTACCTTCTGGCTA No data
Right 1132667110 16:1086573-1086595 GAGTAATGCTGCTGTGAACATGG 0: 10
1: 120
2: 673
3: 1655
4: 2645

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132667108 Original CRISPR TAGCCAGAAGGTAGCTGCTG TGG (reversed) Intergenic
No off target data available for this crispr