ID: 1132670848

View in Genome Browser
Species Human (GRCh38)
Location 16:1101801-1101823
Sequence CGCCCTCGACACAGCCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132670848_1132670860 13 Left 1132670848 16:1101801-1101823 CCCCTGGGGCTGTGTCGAGGGCG No data
Right 1132670860 16:1101837-1101859 CCCAGGGGAGGTGCAGATGAAGG No data
1132670848_1132670854 -4 Left 1132670848 16:1101801-1101823 CCCCTGGGGCTGTGTCGAGGGCG No data
Right 1132670854 16:1101820-1101842 GGCGGCTCTGTCCAGGGCCCAGG No data
1132670848_1132670857 1 Left 1132670848 16:1101801-1101823 CCCCTGGGGCTGTGTCGAGGGCG No data
Right 1132670857 16:1101825-1101847 CTCTGTCCAGGGCCCAGGGGAGG No data
1132670848_1132670855 -3 Left 1132670848 16:1101801-1101823 CCCCTGGGGCTGTGTCGAGGGCG No data
Right 1132670855 16:1101821-1101843 GCGGCTCTGTCCAGGGCCCAGGG No data
1132670848_1132670856 -2 Left 1132670848 16:1101801-1101823 CCCCTGGGGCTGTGTCGAGGGCG No data
Right 1132670856 16:1101822-1101844 CGGCTCTGTCCAGGGCCCAGGGG No data
1132670848_1132670853 -10 Left 1132670848 16:1101801-1101823 CCCCTGGGGCTGTGTCGAGGGCG No data
Right 1132670853 16:1101814-1101836 GTCGAGGGCGGCTCTGTCCAGGG No data
1132670848_1132670862 27 Left 1132670848 16:1101801-1101823 CCCCTGGGGCTGTGTCGAGGGCG No data
Right 1132670862 16:1101851-1101873 AGATGAAGGACCGTCGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132670848 Original CRISPR CGCCCTCGACACAGCCCCAG GGG (reversed) Intergenic
No off target data available for this crispr