ID: 1132670854

View in Genome Browser
Species Human (GRCh38)
Location 16:1101820-1101842
Sequence GGCGGCTCTGTCCAGGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132670839_1132670854 14 Left 1132670839 16:1101783-1101805 CCAGCCAGAGGCACCCAGCCCCT No data
Right 1132670854 16:1101820-1101842 GGCGGCTCTGTCCAGGGCCCAGG No data
1132670837_1132670854 16 Left 1132670837 16:1101781-1101803 CCCCAGCCAGAGGCACCCAGCCC No data
Right 1132670854 16:1101820-1101842 GGCGGCTCTGTCCAGGGCCCAGG No data
1132670844_1132670854 1 Left 1132670844 16:1101796-1101818 CCCAGCCCCTGGGGCTGTGTCGA No data
Right 1132670854 16:1101820-1101842 GGCGGCTCTGTCCAGGGCCCAGG No data
1132670845_1132670854 0 Left 1132670845 16:1101797-1101819 CCAGCCCCTGGGGCTGTGTCGAG No data
Right 1132670854 16:1101820-1101842 GGCGGCTCTGTCCAGGGCCCAGG No data
1132670836_1132670854 22 Left 1132670836 16:1101775-1101797 CCGGAACCCCAGCCAGAGGCACC No data
Right 1132670854 16:1101820-1101842 GGCGGCTCTGTCCAGGGCCCAGG No data
1132670849_1132670854 -5 Left 1132670849 16:1101802-1101824 CCCTGGGGCTGTGTCGAGGGCGG No data
Right 1132670854 16:1101820-1101842 GGCGGCTCTGTCCAGGGCCCAGG No data
1132670851_1132670854 -6 Left 1132670851 16:1101803-1101825 CCTGGGGCTGTGTCGAGGGCGGC No data
Right 1132670854 16:1101820-1101842 GGCGGCTCTGTCCAGGGCCCAGG No data
1132670838_1132670854 15 Left 1132670838 16:1101782-1101804 CCCAGCCAGAGGCACCCAGCCCC No data
Right 1132670854 16:1101820-1101842 GGCGGCTCTGTCCAGGGCCCAGG No data
1132670848_1132670854 -4 Left 1132670848 16:1101801-1101823 CCCCTGGGGCTGTGTCGAGGGCG No data
Right 1132670854 16:1101820-1101842 GGCGGCTCTGTCCAGGGCCCAGG No data
1132670842_1132670854 10 Left 1132670842 16:1101787-1101809 CCAGAGGCACCCAGCCCCTGGGG No data
Right 1132670854 16:1101820-1101842 GGCGGCTCTGTCCAGGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132670854 Original CRISPR GGCGGCTCTGTCCAGGGCCC AGG Intergenic
No off target data available for this crispr