ID: 1132670860

View in Genome Browser
Species Human (GRCh38)
Location 16:1101837-1101859
Sequence CCCAGGGGAGGTGCAGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132670848_1132670860 13 Left 1132670848 16:1101801-1101823 CCCCTGGGGCTGTGTCGAGGGCG No data
Right 1132670860 16:1101837-1101859 CCCAGGGGAGGTGCAGATGAAGG No data
1132670842_1132670860 27 Left 1132670842 16:1101787-1101809 CCAGAGGCACCCAGCCCCTGGGG No data
Right 1132670860 16:1101837-1101859 CCCAGGGGAGGTGCAGATGAAGG No data
1132670844_1132670860 18 Left 1132670844 16:1101796-1101818 CCCAGCCCCTGGGGCTGTGTCGA No data
Right 1132670860 16:1101837-1101859 CCCAGGGGAGGTGCAGATGAAGG No data
1132670845_1132670860 17 Left 1132670845 16:1101797-1101819 CCAGCCCCTGGGGCTGTGTCGAG No data
Right 1132670860 16:1101837-1101859 CCCAGGGGAGGTGCAGATGAAGG No data
1132670851_1132670860 11 Left 1132670851 16:1101803-1101825 CCTGGGGCTGTGTCGAGGGCGGC No data
Right 1132670860 16:1101837-1101859 CCCAGGGGAGGTGCAGATGAAGG No data
1132670849_1132670860 12 Left 1132670849 16:1101802-1101824 CCCTGGGGCTGTGTCGAGGGCGG No data
Right 1132670860 16:1101837-1101859 CCCAGGGGAGGTGCAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132670860 Original CRISPR CCCAGGGGAGGTGCAGATGA AGG Intergenic
No off target data available for this crispr