ID: 1132670862

View in Genome Browser
Species Human (GRCh38)
Location 16:1101851-1101873
Sequence AGATGAAGGACCGTCGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132670848_1132670862 27 Left 1132670848 16:1101801-1101823 CCCCTGGGGCTGTGTCGAGGGCG No data
Right 1132670862 16:1101851-1101873 AGATGAAGGACCGTCGTTCATGG No data
1132670859_1132670862 -9 Left 1132670859 16:1101837-1101859 CCCAGGGGAGGTGCAGATGAAGG No data
Right 1132670862 16:1101851-1101873 AGATGAAGGACCGTCGTTCATGG No data
1132670861_1132670862 -10 Left 1132670861 16:1101838-1101860 CCAGGGGAGGTGCAGATGAAGGA No data
Right 1132670862 16:1101851-1101873 AGATGAAGGACCGTCGTTCATGG No data
1132670858_1132670862 -3 Left 1132670858 16:1101831-1101853 CCAGGGCCCAGGGGAGGTGCAGA No data
Right 1132670862 16:1101851-1101873 AGATGAAGGACCGTCGTTCATGG No data
1132670849_1132670862 26 Left 1132670849 16:1101802-1101824 CCCTGGGGCTGTGTCGAGGGCGG No data
Right 1132670862 16:1101851-1101873 AGATGAAGGACCGTCGTTCATGG No data
1132670851_1132670862 25 Left 1132670851 16:1101803-1101825 CCTGGGGCTGTGTCGAGGGCGGC No data
Right 1132670862 16:1101851-1101873 AGATGAAGGACCGTCGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132670862 Original CRISPR AGATGAAGGACCGTCGTTCA TGG Intergenic
No off target data available for this crispr