ID: 1132673378

View in Genome Browser
Species Human (GRCh38)
Location 16:1111640-1111662
Sequence CTTTGTAAGGCCAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132673378_1132673385 -8 Left 1132673378 16:1111640-1111662 CCACCCACCTTGGCCTTACAAAG No data
Right 1132673385 16:1111655-1111677 TTACAAAGTGCTGGGATGACAGG 0: 1
1: 196
2: 16083
3: 321701
4: 263869
1132673378_1132673386 11 Left 1132673378 16:1111640-1111662 CCACCCACCTTGGCCTTACAAAG No data
Right 1132673386 16:1111674-1111696 CAGGCATGAGCCACCGTGCCCGG 0: 6929
1: 41657
2: 112181
3: 156808
4: 166907
1132673378_1132673387 15 Left 1132673378 16:1111640-1111662 CCACCCACCTTGGCCTTACAAAG No data
Right 1132673387 16:1111678-1111700 CATGAGCCACCGTGCCCGGCCGG 0: 115
1: 1009
2: 3849
3: 6107
4: 7044

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132673378 Original CRISPR CTTTGTAAGGCCAAGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr