ID: 1132675877

View in Genome Browser
Species Human (GRCh38)
Location 16:1121055-1121077
Sequence GAGAATTCCAGCCCACAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132675877_1132675883 27 Left 1132675877 16:1121055-1121077 CCGGCTTGTGGGCTGGAATTCTC No data
Right 1132675883 16:1121105-1121127 ACTCCCTCCCATGCACAACAGGG No data
1132675877_1132675885 30 Left 1132675877 16:1121055-1121077 CCGGCTTGTGGGCTGGAATTCTC No data
Right 1132675885 16:1121108-1121130 CCCTCCCATGCACAACAGGGAGG No data
1132675877_1132675882 26 Left 1132675877 16:1121055-1121077 CCGGCTTGTGGGCTGGAATTCTC No data
Right 1132675882 16:1121104-1121126 AACTCCCTCCCATGCACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132675877 Original CRISPR GAGAATTCCAGCCCACAAGC CGG (reversed) Intergenic
No off target data available for this crispr