ID: 1132676108

View in Genome Browser
Species Human (GRCh38)
Location 16:1121878-1121900
Sequence CTCTGTGTGTGAGGGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132676102_1132676108 -7 Left 1132676102 16:1121862-1121884 CCCTGGTGAGAAAGCACTCTGTG No data
Right 1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG No data
1132676092_1132676108 24 Left 1132676092 16:1121831-1121853 CCCGTGCAGCCCCGGGGGTCCCG No data
Right 1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG No data
1132676096_1132676108 14 Left 1132676096 16:1121841-1121863 CCCGGGGGTCCCGCCTAGAGGCC No data
Right 1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG No data
1132676093_1132676108 23 Left 1132676093 16:1121832-1121854 CCGTGCAGCCCCGGGGGTCCCGC No data
Right 1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG No data
1132676103_1132676108 -8 Left 1132676103 16:1121863-1121885 CCTGGTGAGAAAGCACTCTGTGT No data
Right 1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG No data
1132676099_1132676108 5 Left 1132676099 16:1121850-1121872 CCCGCCTAGAGGCCCTGGTGAGA No data
Right 1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG No data
1132676101_1132676108 1 Left 1132676101 16:1121854-1121876 CCTAGAGGCCCTGGTGAGAAAGC No data
Right 1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG No data
1132676097_1132676108 13 Left 1132676097 16:1121842-1121864 CCGGGGGTCCCGCCTAGAGGCCC No data
Right 1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG No data
1132676100_1132676108 4 Left 1132676100 16:1121851-1121873 CCGCCTAGAGGCCCTGGTGAGAA No data
Right 1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG No data
1132676095_1132676108 15 Left 1132676095 16:1121840-1121862 CCCCGGGGGTCCCGCCTAGAGGC No data
Right 1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132676108 Original CRISPR CTCTGTGTGTGAGGGGCACA GGG Intergenic
No off target data available for this crispr