ID: 1132677353

View in Genome Browser
Species Human (GRCh38)
Location 16:1126299-1126321
Sequence CGGTTCCAGCACCGGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132677353_1132677360 -1 Left 1132677353 16:1126299-1126321 CCAGCTCCCCGGTGCTGGAACCG No data
Right 1132677360 16:1126321-1126343 GACTCCATGGTCACCTGGTGAGG No data
1132677353_1132677363 3 Left 1132677353 16:1126299-1126321 CCAGCTCCCCGGTGCTGGAACCG No data
Right 1132677363 16:1126325-1126347 CCATGGTCACCTGGTGAGGGAGG No data
1132677353_1132677358 -6 Left 1132677353 16:1126299-1126321 CCAGCTCCCCGGTGCTGGAACCG No data
Right 1132677358 16:1126316-1126338 GAACCGACTCCATGGTCACCTGG No data
1132677353_1132677361 0 Left 1132677353 16:1126299-1126321 CCAGCTCCCCGGTGCTGGAACCG No data
Right 1132677361 16:1126322-1126344 ACTCCATGGTCACCTGGTGAGGG No data
1132677353_1132677364 9 Left 1132677353 16:1126299-1126321 CCAGCTCCCCGGTGCTGGAACCG No data
Right 1132677364 16:1126331-1126353 TCACCTGGTGAGGGAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132677353 Original CRISPR CGGTTCCAGCACCGGGGAGC TGG (reversed) Intergenic
No off target data available for this crispr