ID: 1132678237

View in Genome Browser
Species Human (GRCh38)
Location 16:1129463-1129485
Sequence CCCTGCTGCGGGGTTTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132678220_1132678237 7 Left 1132678220 16:1129433-1129455 CCAGCCTGGCCGCCCTCCGCCCG No data
Right 1132678237 16:1129463-1129485 CCCTGCTGCGGGGTTTTCCTGGG No data
1132678214_1132678237 28 Left 1132678214 16:1129412-1129434 CCTCCTCTGTGGCCCTCGCACCC No data
Right 1132678237 16:1129463-1129485 CCCTGCTGCGGGGTTTTCCTGGG No data
1132678225_1132678237 -5 Left 1132678225 16:1129445-1129467 CCCTCCGCCCGGGCCTGCCCCTG No data
Right 1132678237 16:1129463-1129485 CCCTGCTGCGGGGTTTTCCTGGG No data
1132678217_1132678237 16 Left 1132678217 16:1129424-1129446 CCCTCGCACCCAGCCTGGCCGCC No data
Right 1132678237 16:1129463-1129485 CCCTGCTGCGGGGTTTTCCTGGG No data
1132678215_1132678237 25 Left 1132678215 16:1129415-1129437 CCTCTGTGGCCCTCGCACCCAGC No data
Right 1132678237 16:1129463-1129485 CCCTGCTGCGGGGTTTTCCTGGG No data
1132678219_1132678237 8 Left 1132678219 16:1129432-1129454 CCCAGCCTGGCCGCCCTCCGCCC No data
Right 1132678237 16:1129463-1129485 CCCTGCTGCGGGGTTTTCCTGGG No data
1132678223_1132678237 3 Left 1132678223 16:1129437-1129459 CCTGGCCGCCCTCCGCCCGGGCC No data
Right 1132678237 16:1129463-1129485 CCCTGCTGCGGGGTTTTCCTGGG No data
1132678227_1132678237 -9 Left 1132678227 16:1129449-1129471 CCGCCCGGGCCTGCCCCTGCTGC No data
Right 1132678237 16:1129463-1129485 CCCTGCTGCGGGGTTTTCCTGGG No data
1132678226_1132678237 -6 Left 1132678226 16:1129446-1129468 CCTCCGCCCGGGCCTGCCCCTGC No data
Right 1132678237 16:1129463-1129485 CCCTGCTGCGGGGTTTTCCTGGG No data
1132678224_1132678237 -2 Left 1132678224 16:1129442-1129464 CCGCCCTCCGCCCGGGCCTGCCC No data
Right 1132678237 16:1129463-1129485 CCCTGCTGCGGGGTTTTCCTGGG No data
1132678218_1132678237 15 Left 1132678218 16:1129425-1129447 CCTCGCACCCAGCCTGGCCGCCC No data
Right 1132678237 16:1129463-1129485 CCCTGCTGCGGGGTTTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132678237 Original CRISPR CCCTGCTGCGGGGTTTTCCT GGG Intergenic