ID: 1132679744

View in Genome Browser
Species Human (GRCh38)
Location 16:1134860-1134882
Sequence CCTTCAGAGGGGCGGGCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132679744_1132679759 15 Left 1132679744 16:1134860-1134882 CCTCAAGCCCGCCCCTCTGAAGG No data
Right 1132679759 16:1134898-1134920 CTGCTGTATGCCCGGTAGGCAGG No data
1132679744_1132679762 22 Left 1132679744 16:1134860-1134882 CCTCAAGCCCGCCCCTCTGAAGG No data
Right 1132679762 16:1134905-1134927 ATGCCCGGTAGGCAGGGCCCGGG No data
1132679744_1132679757 11 Left 1132679744 16:1134860-1134882 CCTCAAGCCCGCCCCTCTGAAGG No data
Right 1132679757 16:1134894-1134916 GCACCTGCTGTATGCCCGGTAGG No data
1132679744_1132679761 21 Left 1132679744 16:1134860-1134882 CCTCAAGCCCGCCCCTCTGAAGG No data
Right 1132679761 16:1134904-1134926 TATGCCCGGTAGGCAGGGCCCGG No data
1132679744_1132679760 16 Left 1132679744 16:1134860-1134882 CCTCAAGCCCGCCCCTCTGAAGG No data
Right 1132679760 16:1134899-1134921 TGCTGTATGCCCGGTAGGCAGGG No data
1132679744_1132679756 7 Left 1132679744 16:1134860-1134882 CCTCAAGCCCGCCCCTCTGAAGG No data
Right 1132679756 16:1134890-1134912 GGGAGCACCTGCTGTATGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132679744 Original CRISPR CCTTCAGAGGGGCGGGCTTG AGG (reversed) Intergenic