ID: 1132679756

View in Genome Browser
Species Human (GRCh38)
Location 16:1134890-1134912
Sequence GGGAGCACCTGCTGTATGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132679742_1132679756 9 Left 1132679742 16:1134858-1134880 CCCCTCAAGCCCGCCCCTCTGAA No data
Right 1132679756 16:1134890-1134912 GGGAGCACCTGCTGTATGCCCGG No data
1132679749_1132679756 -1 Left 1132679749 16:1134868-1134890 CCGCCCCTCTGAAGGGAGGTTGG No data
Right 1132679756 16:1134890-1134912 GGGAGCACCTGCTGTATGCCCGG No data
1132679741_1132679756 12 Left 1132679741 16:1134855-1134877 CCTCCCCTCAAGCCCGCCCCTCT No data
Right 1132679756 16:1134890-1134912 GGGAGCACCTGCTGTATGCCCGG No data
1132679744_1132679756 7 Left 1132679744 16:1134860-1134882 CCTCAAGCCCGCCCCTCTGAAGG No data
Right 1132679756 16:1134890-1134912 GGGAGCACCTGCTGTATGCCCGG No data
1132679743_1132679756 8 Left 1132679743 16:1134859-1134881 CCCTCAAGCCCGCCCCTCTGAAG No data
Right 1132679756 16:1134890-1134912 GGGAGCACCTGCTGTATGCCCGG No data
1132679755_1132679756 -6 Left 1132679755 16:1134873-1134895 CCTCTGAAGGGAGGTTGGGGAGC No data
Right 1132679756 16:1134890-1134912 GGGAGCACCTGCTGTATGCCCGG No data
1132679748_1132679756 0 Left 1132679748 16:1134867-1134889 CCCGCCCCTCTGAAGGGAGGTTG No data
Right 1132679756 16:1134890-1134912 GGGAGCACCTGCTGTATGCCCGG No data
1132679754_1132679756 -5 Left 1132679754 16:1134872-1134894 CCCTCTGAAGGGAGGTTGGGGAG No data
Right 1132679756 16:1134890-1134912 GGGAGCACCTGCTGTATGCCCGG No data
1132679753_1132679756 -4 Left 1132679753 16:1134871-1134893 CCCCTCTGAAGGGAGGTTGGGGA No data
Right 1132679756 16:1134890-1134912 GGGAGCACCTGCTGTATGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132679756 Original CRISPR GGGAGCACCTGCTGTATGCC CGG Intergenic