ID: 1132682004

View in Genome Browser
Species Human (GRCh38)
Location 16:1146265-1146287
Sequence CTGTGGAGTGGGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132682004_1132682015 3 Left 1132682004 16:1146265-1146287 CCCTCCTCCTTCCCACTCCACAG No data
Right 1132682015 16:1146291-1146313 TCCGGGGGATTCAGCAGCTCAGG No data
1132682004_1132682017 12 Left 1132682004 16:1146265-1146287 CCCTCCTCCTTCCCACTCCACAG No data
Right 1132682017 16:1146300-1146322 TTCAGCAGCTCAGGCAGAGTTGG No data
1132682004_1132682018 13 Left 1132682004 16:1146265-1146287 CCCTCCTCCTTCCCACTCCACAG No data
Right 1132682018 16:1146301-1146323 TCAGCAGCTCAGGCAGAGTTGGG No data
1132682004_1132682019 23 Left 1132682004 16:1146265-1146287 CCCTCCTCCTTCCCACTCCACAG No data
Right 1132682019 16:1146311-1146333 AGGCAGAGTTGGGTGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132682004 Original CRISPR CTGTGGAGTGGGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr