ID: 1132682485

View in Genome Browser
Species Human (GRCh38)
Location 16:1148846-1148868
Sequence CCCGCCCAGCACGGTCTCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132682479_1132682485 3 Left 1132682479 16:1148820-1148842 CCATCCCACAGTGTGGGGTCATG No data
Right 1132682485 16:1148846-1148868 CCCGCCCAGCACGGTCTCGAGGG No data
1132682480_1132682485 -1 Left 1132682480 16:1148824-1148846 CCCACAGTGTGGGGTCATGCTTC No data
Right 1132682485 16:1148846-1148868 CCCGCCCAGCACGGTCTCGAGGG No data
1132682481_1132682485 -2 Left 1132682481 16:1148825-1148847 CCACAGTGTGGGGTCATGCTTCC No data
Right 1132682485 16:1148846-1148868 CCCGCCCAGCACGGTCTCGAGGG No data
1132682473_1132682485 12 Left 1132682473 16:1148811-1148833 CCAGGCTCCCCATCCCACAGTGT No data
Right 1132682485 16:1148846-1148868 CCCGCCCAGCACGGTCTCGAGGG No data
1132682472_1132682485 15 Left 1132682472 16:1148808-1148830 CCACCAGGCTCCCCATCCCACAG No data
Right 1132682485 16:1148846-1148868 CCCGCCCAGCACGGTCTCGAGGG No data
1132682477_1132682485 5 Left 1132682477 16:1148818-1148840 CCCCATCCCACAGTGTGGGGTCA No data
Right 1132682485 16:1148846-1148868 CCCGCCCAGCACGGTCTCGAGGG No data
1132682471_1132682485 22 Left 1132682471 16:1148801-1148823 CCGGCAGCCACCAGGCTCCCCAT No data
Right 1132682485 16:1148846-1148868 CCCGCCCAGCACGGTCTCGAGGG No data
1132682478_1132682485 4 Left 1132682478 16:1148819-1148841 CCCATCCCACAGTGTGGGGTCAT No data
Right 1132682485 16:1148846-1148868 CCCGCCCAGCACGGTCTCGAGGG No data
1132682470_1132682485 26 Left 1132682470 16:1148797-1148819 CCAGCCGGCAGCCACCAGGCTCC No data
Right 1132682485 16:1148846-1148868 CCCGCCCAGCACGGTCTCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132682485 Original CRISPR CCCGCCCAGCACGGTCTCGA GGG Intergenic
No off target data available for this crispr