ID: 1132686251

View in Genome Browser
Species Human (GRCh38)
Location 16:1163332-1163354
Sequence CGTAGCTCCACACCGTACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132686251_1132686261 13 Left 1132686251 16:1163332-1163354 CCGGGGTACGGTGTGGAGCTACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1132686261 16:1163368-1163390 CACCTCGTGCTCCCGGGAGGGGG 0: 1
1: 0
2: 1
3: 17
4: 239
1132686251_1132686255 6 Left 1132686251 16:1163332-1163354 CCGGGGTACGGTGTGGAGCTACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1132686255 16:1163361-1163383 CCCATGGCACCTCGTGCTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 143
1132686251_1132686268 30 Left 1132686251 16:1163332-1163354 CCGGGGTACGGTGTGGAGCTACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1132686268 16:1163385-1163407 AGGGGGTGCTGGTCTGGCCTGGG 0: 1
1: 0
2: 2
3: 35
4: 344
1132686251_1132686252 -10 Left 1132686251 16:1163332-1163354 CCGGGGTACGGTGTGGAGCTACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1132686252 16:1163345-1163367 TGGAGCTACGAGTCTCCCCATGG 0: 1
1: 0
2: 0
3: 2
4: 71
1132686251_1132686265 24 Left 1132686251 16:1163332-1163354 CCGGGGTACGGTGTGGAGCTACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1132686265 16:1163379-1163401 CCCGGGAGGGGGTGCTGGTCTGG 0: 1
1: 0
2: 1
3: 38
4: 643
1132686251_1132686257 7 Left 1132686251 16:1163332-1163354 CCGGGGTACGGTGTGGAGCTACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1132686257 16:1163362-1163384 CCATGGCACCTCGTGCTCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 176
1132686251_1132686259 11 Left 1132686251 16:1163332-1163354 CCGGGGTACGGTGTGGAGCTACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1132686259 16:1163366-1163388 GGCACCTCGTGCTCCCGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 106
1132686251_1132686263 19 Left 1132686251 16:1163332-1163354 CCGGGGTACGGTGTGGAGCTACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1132686263 16:1163374-1163396 GTGCTCCCGGGAGGGGGTGCTGG 0: 1
1: 1
2: 1
3: 29
4: 620
1132686251_1132686267 29 Left 1132686251 16:1163332-1163354 CCGGGGTACGGTGTGGAGCTACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1132686267 16:1163384-1163406 GAGGGGGTGCTGGTCTGGCCTGG 0: 1
1: 0
2: 3
3: 41
4: 368
1132686251_1132686258 10 Left 1132686251 16:1163332-1163354 CCGGGGTACGGTGTGGAGCTACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1132686258 16:1163365-1163387 TGGCACCTCGTGCTCCCGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 102
1132686251_1132686260 12 Left 1132686251 16:1163332-1163354 CCGGGGTACGGTGTGGAGCTACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1132686260 16:1163367-1163389 GCACCTCGTGCTCCCGGGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132686251 Original CRISPR CGTAGCTCCACACCGTACCC CGG (reversed) Intronic