ID: 1132686259

View in Genome Browser
Species Human (GRCh38)
Location 16:1163366-1163388
Sequence GGCACCTCGTGCTCCCGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132686247_1132686259 26 Left 1132686247 16:1163317-1163339 CCTGGGAGGCCGGCGCCGGGGTA 0: 1
1: 0
2: 0
3: 17
4: 206
Right 1132686259 16:1163366-1163388 GGCACCTCGTGCTCCCGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 106
1132686250_1132686259 17 Left 1132686250 16:1163326-1163348 CCGGCGCCGGGGTACGGTGTGGA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1132686259 16:1163366-1163388 GGCACCTCGTGCTCCCGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 106
1132686251_1132686259 11 Left 1132686251 16:1163332-1163354 CCGGGGTACGGTGTGGAGCTACG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1132686259 16:1163366-1163388 GGCACCTCGTGCTCCCGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132686259 Original CRISPR GGCACCTCGTGCTCCCGGGA GGG Intronic