ID: 1132687645

View in Genome Browser
Species Human (GRCh38)
Location 16:1168945-1168967
Sequence GACTCACCCCAGGCGGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132687645_1132687656 9 Left 1132687645 16:1168945-1168967 CCCCTGCCCGCCTGGGGTGAGTC 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1132687656 16:1168977-1168999 TGGAGTCTTAGGGTGATGCCAGG 0: 1
1: 0
2: 1
3: 17
4: 277
1132687645_1132687659 25 Left 1132687645 16:1168945-1168967 CCCCTGCCCGCCTGGGGTGAGTC 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1132687659 16:1168993-1169015 TGCCAGGGCGTTCTCTGCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 137
1132687645_1132687657 10 Left 1132687645 16:1168945-1168967 CCCCTGCCCGCCTGGGGTGAGTC 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1132687657 16:1168978-1169000 GGAGTCTTAGGGTGATGCCAGGG 0: 1
1: 0
2: 1
3: 15
4: 299
1132687645_1132687658 24 Left 1132687645 16:1168945-1168967 CCCCTGCCCGCCTGGGGTGAGTC 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1132687658 16:1168992-1169014 ATGCCAGGGCGTTCTCTGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 123
1132687645_1132687652 -2 Left 1132687645 16:1168945-1168967 CCCCTGCCCGCCTGGGGTGAGTC 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1132687652 16:1168966-1168988 TCTGCCCACAGTGGAGTCTTAGG 0: 1
1: 0
2: 0
3: 17
4: 175
1132687645_1132687653 -1 Left 1132687645 16:1168945-1168967 CCCCTGCCCGCCTGGGGTGAGTC 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1132687653 16:1168967-1168989 CTGCCCACAGTGGAGTCTTAGGG 0: 1
1: 0
2: 0
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132687645 Original CRISPR GACTCACCCCAGGCGGGCAG GGG (reversed) Intronic
900803214 1:4750600-4750622 CACTCATCCCAGCCTGGCAGAGG - Intronic
901013080 1:6211855-6211877 CTCTCTCCCCAGGCTGGCAGGGG + Exonic
901924649 1:12558328-12558350 GAGACACCCCAGGAGAGCAGGGG - Intergenic
901930015 1:12591212-12591234 GGCTGACCCCAGGAGGTCAGAGG + Intronic
902162518 1:14542796-14542818 GACTCACCCCGGGCAAGCGGGGG + Intergenic
904271530 1:29353473-29353495 GACTTCCCCCAGCCTGGCAGAGG - Intergenic
914685377 1:149974146-149974168 GCCTGAACCCAGGAGGGCAGAGG - Intronic
916070473 1:161166919-161166941 CACTCACCTTAGGGGGGCAGGGG - Exonic
917456731 1:175192412-175192434 GACTCAGCCCAGGCGCAGAGAGG + Intronic
917623137 1:176818602-176818624 GGCTCATACCAGGGGGGCAGTGG - Intronic
918105619 1:181413200-181413222 GGCTCCCCGCAGCCGGGCAGGGG - Intronic
924412363 1:243819499-243819521 GACTCAGCCCCTGCGGGGAGAGG + Intronic
1062771306 10:103936-103958 GGCTCACCCCTGGCAGGCATGGG - Intergenic
1063048603 10:2420210-2420232 GACTCACCAGAGGCTGGAAGAGG + Intergenic
1063391963 10:5655687-5655709 CACTAACCTCAGGAGGGCAGTGG - Intronic
1063584821 10:7342685-7342707 GACTCACTCCAGGCCGGGCGTGG - Intronic
1069248984 10:66245082-66245104 GACTCACCCTTGGCAGGCATGGG - Intronic
1069849030 10:71393189-71393211 GACTCTCCCCAGGCAGCCATGGG - Intergenic
1070942000 10:80356581-80356603 GACTCACCTGAGGCGGAGAGAGG - Intronic
1072307451 10:94121271-94121293 GTCTCAGCCCAGGAGGGCAGAGG + Intronic
1072687952 10:97549922-97549944 GGATCAGCCCAGGCGGGGAGGGG - Intronic
1075177689 10:120181288-120181310 GCCACACCGCAGGCTGGCAGAGG + Intergenic
1077034867 11:489758-489780 GAGACACCCCCGGGGGGCAGGGG + Intronic
1077137075 11:1005688-1005710 AACAGACCCCTGGCGGGCAGAGG - Intronic
1078577676 11:12515759-12515781 GACTCACCCTAGGTGGACACGGG - Intronic
1083990484 11:66243323-66243345 GCCTCACCGCCTGCGGGCAGGGG + Exonic
1084321722 11:68377103-68377125 GCCACTCCCCAGGCAGGCAGTGG - Intronic
1089152437 11:116374370-116374392 GACCCAGCCCATGCAGGCAGCGG - Intergenic
1089609844 11:119663136-119663158 AACTCACCCCAGGGTGTCAGGGG - Exonic
1091920956 12:4304094-4304116 GACTCTCTCCAAGAGGGCAGGGG + Exonic
1092055653 12:5506184-5506206 GCCTCACCTAAGGGGGGCAGGGG + Intronic
1092172938 12:6384671-6384693 GCCTCTCACCTGGCGGGCAGCGG - Exonic
1095221837 12:39625516-39625538 GCTTCAACCCAGGAGGGCAGAGG - Intergenic
1097129818 12:56803856-56803878 GACTCACCCTTGGCAGGCATGGG - Intergenic
1101409993 12:104459308-104459330 GACTCACCCCAGAGCGCCAGGGG + Intronic
1102471596 12:113162705-113162727 CACTCACCCCAGGCATGGAGGGG + Intronic
1104801326 12:131556802-131556824 GCCTTTCCTCAGGCGGGCAGGGG + Intergenic
1104854664 12:131896077-131896099 GACTGACGCCCGGCGGGGAGGGG - Intronic
1105923076 13:24983101-24983123 GACTCACTCCAGGCCAGGAGAGG + Intergenic
1113708950 13:112451861-112451883 GATGCTCTCCAGGCGGGCAGGGG - Intergenic
1113790240 13:113024632-113024654 GTCTCTCCCCAGGTGGGCGGGGG + Exonic
1122879068 14:104681950-104681972 CACTCTCCCAAGGCGGGAAGTGG + Intergenic
1124137497 15:27048090-27048112 GCCTCTCCCCAGGCTGGAAGAGG - Intronic
1127343045 15:58066327-58066349 GACTCCCCTCAGCCGGGCCGAGG + Exonic
1129170296 15:73803520-73803542 CCCTCACTCCAGGAGGGCAGGGG + Intergenic
1129691637 15:77717340-77717362 GGCAGCCCCCAGGCGGGCAGAGG + Intronic
1129821411 15:78604532-78604554 GACACACCCCAGGGGTGCTGTGG - Intronic
1132665200 16:1078350-1078372 CATTCATCCCAGGCGGACAGGGG + Intergenic
1132687645 16:1168945-1168967 GACTCACCCCAGGCGGGCAGGGG - Intronic
1132832071 16:1933309-1933331 GAGCCACCCGGGGCGGGCAGGGG - Intergenic
1132835356 16:1950268-1950290 GACAGACTCCAGGCAGGCAGAGG - Intronic
1133002822 16:2859730-2859752 GGCTCACCCCAGGCAGGGTGAGG - Intergenic
1133492289 16:6281899-6281921 TATTCAACTCAGGCGGGCAGTGG - Intronic
1133995334 16:10743975-10743997 GACAGCGCCCAGGCGGGCAGAGG + Exonic
1134131648 16:11654365-11654387 GTCCCACCCCAGGGGAGCAGTGG - Intergenic
1135521757 16:23183113-23183135 GACTCACCCCGGCAGGGAAGGGG - Intronic
1139750635 16:69107134-69107156 GTGTCACCCCAAGCCGGCAGAGG - Intronic
1140743344 16:77960868-77960890 GGCTCACCCCATGCAAGCAGAGG - Intronic
1142065483 16:88059943-88059965 CACACACCCCAGGAGGGCTGAGG + Intronic
1142249204 16:88983388-88983410 CAGCCACCCCAGGCGGGTAGTGG + Intergenic
1143323053 17:6080521-6080543 GAGTGACCCCAGGCGAGCACAGG + Exonic
1143542452 17:7577717-7577739 GACCCACAACAGGCTGGCAGCGG - Intronic
1145266313 17:21381173-21381195 GGCTCAGTCCAGGTGGGCAGGGG - Intronic
1148776039 17:50096200-50096222 GCCTCTCCCCAGCTGGGCAGGGG + Intronic
1151943710 17:77307886-77307908 GACTCAGCCCTGGGGGGCAAGGG - Intronic
1152607789 17:81301766-81301788 GCCTCACCACAGACGTGCAGCGG - Intergenic
1152846776 17:82605376-82605398 TACTCACCCCAGGGTAGCAGAGG + Intronic
1152922661 17:83073656-83073678 GACTCAGCCCAGGCAGGCGGGGG - Intergenic
1154412918 18:14151000-14151022 GACGCACCTCAGCCGGGCACTGG - Intergenic
1155685142 18:28539302-28539324 GACTTGCCCCAGCCAGGCAGAGG - Intergenic
1155736227 18:29225816-29225838 CACTGACCCCAGGCTAGCAGTGG - Intergenic
1155928846 18:31685227-31685249 GCCTCACCCCGGGCGCGCGGCGG - Intronic
1157991736 18:52504580-52504602 CAGTCACCCCAAGCTGGCAGGGG - Intronic
1163154197 19:15431295-15431317 GACTCACCCCAGGAAAGCTGAGG + Intronic
1163177043 19:15571697-15571719 GGCTGACACCAGGCTGGCAGGGG - Intergenic
1163207751 19:15815846-15815868 GACTCACCCCTGGCAGGCGGGGG - Intergenic
1165453707 19:35899287-35899309 GCCTCACCCCGGGCCGGGAGCGG + Intronic
1166912989 19:46174094-46174116 TTCTCAGCCCAGGCAGGCAGGGG - Intergenic
1168162853 19:54523633-54523655 GAATGAGCCCAGGCTGGCAGAGG + Intergenic
1168636436 19:58000676-58000698 GACTCACCCCAGGAGGCCCATGG + Exonic
1168636512 19:58001282-58001304 GACTCACCCCAGGAGGCCCACGG + Exonic
926004792 2:9365395-9365417 GACTCACCCCAGGAGAGAACAGG - Intronic
929754750 2:44755377-44755399 GAATCACCCAAGGCCGACAGGGG - Intronic
929764410 2:44832217-44832239 CACTCACCCCAGTGGGGAAGAGG + Intergenic
932403837 2:71500530-71500552 GAGGCACCCCAGGCTGGCAGGGG + Intronic
940888163 2:159008833-159008855 GACTCTCCCCAGTTGAGCAGAGG - Intronic
944490586 2:200254331-200254353 GCTTCAACCCAGGGGGGCAGAGG - Intergenic
947840873 2:233207241-233207263 GTCTCACTCCAGGAGGGCACTGG - Exonic
948827626 2:240580500-240580522 GGCCCACCTCAGGCTGGCAGGGG + Exonic
1168890591 20:1293446-1293468 GCCTCTCCCCAGGTGGCCAGAGG - Intronic
1168893632 20:1309501-1309523 GCCTGACCCCAAGAGGGCAGTGG - Intergenic
1169117108 20:3072747-3072769 GCCTCAGCCCAGGCTGGGAGCGG - Intergenic
1170043720 20:12064617-12064639 GACTCACCCTTGGCAGGCATGGG - Intergenic
1174386786 20:50192091-50192113 GTCTCAGCCCCGGCCGGCAGGGG - Exonic
1176427767 21:6559279-6559301 GCCTCTTCCCAGGCTGGCAGGGG + Intergenic
1179144231 21:38753047-38753069 TACCCACCCCTGGCGGGCGGTGG - Intergenic
1179703259 21:43167596-43167618 GCCTCTTCCCAGGCTGGCAGGGG + Intergenic
1179803057 21:43820654-43820676 GAGTCACCCGAAGCGGGGAGGGG + Intergenic
1181458724 22:23073836-23073858 TGCTCACACCAGACGGGCAGGGG + Intronic
1183634587 22:39053314-39053336 AACTCACCCTAGGCTGGCCGCGG + Exonic
1183649026 22:39143809-39143831 TACACAGCCCAGGCGTGCAGTGG + Intronic
1184271252 22:43385600-43385622 GCCGCACCCCAGCCTGGCAGAGG + Intergenic
1184620310 22:45671841-45671863 GACTCGCCTCAGGCGGGAGGAGG - Exonic
1184860357 22:47169985-47170007 CACCCACACCAGGCAGGCAGAGG - Intronic
1184888864 22:47367424-47367446 GACACACTCCAGGCAGGCAGGGG + Intergenic
952969992 3:38644748-38644770 CACTCGCCTCAGGCTGGCAGCGG - Intronic
954366959 3:50151375-50151397 GGCTCACCTCAGGTGGGGAGAGG - Intergenic
954421270 3:50420282-50420304 GATGGACCCCAGCCGGGCAGGGG - Intronic
959476925 3:106822495-106822517 GACTCACCCTTGGCAGGCATGGG + Intergenic
961393679 3:126571343-126571365 CAGCCACCCCAGGTGGGCAGAGG - Intergenic
968690246 4:1986512-1986534 GCCAAACCCCTGGCGGGCAGCGG + Intronic
968874076 4:3256033-3256055 CACTCAGGCCAGGCGGGCAAGGG + Exonic
972317120 4:37937134-37937156 GACTCTCACAAGGAGGGCAGTGG - Intronic
975405207 4:73981410-73981432 GACTCACATCAGTTGGGCAGTGG + Exonic
975614587 4:76234109-76234131 GTCTCAGCCCAGGCAGGGAGGGG + Intronic
980772378 4:137393188-137393210 CACACACACCAGGCGGGGAGAGG - Intergenic
983784693 4:171716272-171716294 GACTCACCCTTGGCAGGCATGGG + Intergenic
984973519 4:185210240-185210262 TACTTACCCCCGGCGGGCGGCGG - Intronic
985530952 5:433637-433659 CACTCGCCCCAGGCACGCAGTGG + Intronic
985621294 5:957512-957534 GACTCACCCCAGCCATGCTGGGG + Intergenic
986070856 5:4280835-4280857 GACTCACCCAGGGCAGGGAGTGG + Intergenic
986204887 5:5614090-5614112 GACTCCCCACAGGTGGGCTGGGG + Intergenic
986337771 5:6767870-6767892 GACACCCCCCATGCGGGCTGAGG - Intergenic
996353981 5:122576781-122576803 GCCTCACCCCAGGAGGGGATTGG + Intergenic
997360650 5:133292479-133292501 GGCACACCCCAGGAGGCCAGTGG - Intronic
998145437 5:139725117-139725139 GACTCACCCCAGCCGGCCACTGG - Intergenic
998613486 5:143714430-143714452 GAATCACTTGAGGCGGGCAGTGG - Intergenic
999143822 5:149379734-149379756 AACTCACCTGAGGCCGGCAGAGG - Intronic
1002447267 5:179297330-179297352 GATTCAGGCCAGGCAGGCAGGGG - Intronic
1002559501 5:180071875-180071897 GCGTCCCCACAGGCGGGCAGTGG - Exonic
1003400000 6:5783201-5783223 GACTCACTCCAGGCCAGGAGAGG + Intergenic
1003722897 6:8724901-8724923 GAAACACCCCAGGCAGGCTGTGG - Intergenic
1005658333 6:27966926-27966948 GGCTCACCCTCGGCGGGCATGGG - Intergenic
1006510492 6:34518672-34518694 GACTCAGTCCAGGAGGGCAGGGG + Intronic
1009684444 6:66937464-66937486 GGCTCACCCCTGGCAGGCATGGG + Intergenic
1013639691 6:112061119-112061141 GGCTCACTCCAGGAGGGCAACGG - Exonic
1016400842 6:143678194-143678216 GACTCACCGCTGCCGGGCTGCGG - Exonic
1017048506 6:150369506-150369528 AATTCATCCCAGGCTGGCAGTGG + Intronic
1024004476 7:45215472-45215494 GACTGAGCCCAGGAGGGCAGGGG + Intergenic
1024325906 7:48109106-48109128 GACTCACCCGAGACAGACAGAGG - Intergenic
1026878771 7:73894966-73894988 GACTCACCACAGGGGGGAGGTGG - Intergenic
1028596171 7:92547750-92547772 GACTCACCCTTGGCAGGCATGGG + Intergenic
1029494929 7:100891356-100891378 GGCTCAGTCCAGACGGGCAGTGG + Intronic
1029590842 7:101506080-101506102 CACTGACCCCATTCGGGCAGAGG - Intronic
1029701284 7:102248482-102248504 GACTCACCCTCGGCCCGCAGCGG + Exonic
1031361950 7:120857841-120857863 GACTATCCCCAGGCGGGCGTGGG - Exonic
1034129130 7:148699257-148699279 GAGTCACCCCGGACGGGCCGGGG + Intronic
1034400104 7:150856542-150856564 GACTCTGCCCAGGAAGGCAGGGG + Exonic
1034895377 7:154872985-154873007 GGCTCACCGGAGGCTGGCAGGGG + Intronic
1036778767 8:11631480-11631502 GACTCATCCCAGGCTGGAGGGGG - Intergenic
1036784479 8:11677048-11677070 GACTCACCCGCGGTGGGGAGCGG - Intronic
1041100573 8:54392680-54392702 GACTCACCAGAGGTGGGCACAGG - Intergenic
1043388158 8:79768022-79768044 GACGCACCGCCGCCGGGCAGGGG - Intergenic
1043482803 8:80669819-80669841 AGGTCACCCCAGGGGGGCAGTGG - Intronic
1044524843 8:93240717-93240739 GACTCACCCTTGGCAGGCATGGG - Intergenic
1048018847 8:130520123-130520145 CACCCACCCCAGGCATGCAGAGG - Intergenic
1048018868 8:130520177-130520199 CACCCACCCCAGGCATGCAGAGG - Intergenic
1048295894 8:133212974-133212996 GGCTGACCCCCAGCGGGCAGCGG - Exonic
1048989064 8:139750714-139750736 GACTCATCCCAGGCAGGCCCAGG - Intronic
1049441593 8:142612183-142612205 GACTCACCCATGGCAGGCGGAGG - Exonic
1049455116 8:142682743-142682765 TGCACACCCCAGGCGGGCACCGG + Intergenic
1049618855 8:143588883-143588905 CCCCCACCCCAGGTGGGCAGGGG + Intronic
1049790004 8:144468161-144468183 GGCTGACCCCAGGAGAGCAGAGG + Intronic
1055620785 9:78122822-78122844 GACTCAACCCAGGGAGGGAGTGG - Intergenic
1056805784 9:89727598-89727620 GAGTGACCACAGGCTGGCAGGGG + Intergenic
1057311617 9:93946621-93946643 GACTTATTCCAGGCAGGCAGGGG + Intergenic
1057975376 9:99600500-99600522 GACTCACCCAGGGTGGGCACAGG + Intergenic
1059407970 9:114113627-114113649 GTCTCCCCCCAGGGAGGCAGAGG - Intergenic
1060396305 9:123319217-123319239 GAGTCTGCCCAGGTGGGCAGCGG - Intergenic
1061449173 9:130659483-130659505 GAGTCTCCCCAGGCGCCCAGGGG - Intergenic
1061552827 9:131347912-131347934 GACTCAAACCATGGGGGCAGCGG + Intergenic
1061700407 9:132410884-132410906 GACGTACCCCAGGCGTGCAGCGG - Intronic
1061881368 9:133570832-133570854 GACAGACCCCAGGTGGGCGGGGG + Intronic
1062144446 9:134981243-134981265 GGCTCAGCCCAGGCTCGCAGTGG + Intergenic
1186630333 X:11341526-11341548 GGATCACCCCAGCAGGGCAGTGG + Intronic
1186669792 X:11757675-11757697 AGCTGGCCCCAGGCGGGCAGTGG - Intergenic
1189910195 X:45803506-45803528 AACTCCCCCCAGGAGGCCAGTGG + Intergenic
1191902364 X:66054032-66054054 GAATCACCCTAGGGGGACAGTGG + Intergenic
1192503114 X:71665958-71665980 GACTCACTCCAGTCGTGGAGAGG - Intergenic
1192503700 X:71668609-71668631 GACTCACCCCAGTCGTGGAGAGG + Intergenic
1192522461 X:71814661-71814683 GACTCACCCCAGCCATGGAGAGG + Intergenic
1195655159 X:107325713-107325735 GACTCACCCTTGGCAGGCATGGG + Intergenic
1201431587 Y:13908236-13908258 TACTGACCCCAGGAGGGGAGGGG + Intergenic