ID: 1132691131

View in Genome Browser
Species Human (GRCh38)
Location 16:1182431-1182453
Sequence GAGCACCGCCCCCAGCGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132691131_1132691149 30 Left 1132691131 16:1182431-1182453 CCCCTGCGCTGGGGGCGGTGCTC 0: 1
1: 0
2: 1
3: 24
4: 291
Right 1132691149 16:1182484-1182506 CTGTGACCCGCGGCGCCGGCTGG 0: 1
1: 0
2: 0
3: 15
4: 141
1132691131_1132691144 20 Left 1132691131 16:1182431-1182453 CCCCTGCGCTGGGGGCGGTGCTC 0: 1
1: 0
2: 1
3: 24
4: 291
Right 1132691144 16:1182474-1182496 CCGTGCCCTCCTGTGACCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 150
1132691131_1132691147 26 Left 1132691131 16:1182431-1182453 CCCCTGCGCTGGGGGCGGTGCTC 0: 1
1: 0
2: 1
3: 24
4: 291
Right 1132691147 16:1182480-1182502 CCTCCTGTGACCCGCGGCGCCGG 0: 1
1: 0
2: 1
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132691131 Original CRISPR GAGCACCGCCCCCAGCGCAG GGG (reversed) Intronic
901045934 1:6395812-6395834 GAGCACCGCCCCCTGCTCCACGG - Intergenic
901227820 1:7624597-7624619 TGGCACAGCCCCCAGCACAGGGG + Intronic
902614792 1:17618002-17618024 GAGCACCGCACCAAGTGCACGGG - Intronic
903776817 1:25799141-25799163 CACCAACCCCCCCAGCGCAGGGG - Intergenic
906563465 1:46778556-46778578 GAGCACCGCCCCCTGCTCCACGG - Intronic
909018976 1:70410828-70410850 TAGCACCGCCCTCAGGGCAAAGG + Intergenic
912532757 1:110338503-110338525 GAGCCCCGCCCCCCGCGCGCGGG - Exonic
912538706 1:110396367-110396389 GAGCACCGCCCCCTGCTCCACGG - Intergenic
915260112 1:154671084-154671106 GAGCACCGCCCCCTGCTCCATGG + Intergenic
915261282 1:154678371-154678393 GAGCACCGCCCCCTGCTCCATGG + Intergenic
917846727 1:179026130-179026152 GACCCCCGCCCCCGGCGCGGCGG + Intronic
918993934 1:191732093-191732115 GAGCGCCGCCCCCTGCTCAACGG + Intergenic
919167903 1:193918950-193918972 GAGCACCACCCCCTGCTCCGCGG - Intergenic
919419725 1:197355433-197355455 GAGCACCACCCCCTGCTCCGCGG - Intronic
919842422 1:201619075-201619097 GAGCAGGGCCCCCACTGCAGTGG + Intergenic
919892013 1:201982600-201982622 GAGCCCCGCCCCGAGCGCCGCGG - Intronic
920881982 1:209888989-209889011 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
921094356 1:211874302-211874324 GAGCGCCGCCCCCTGCTCTGTGG - Intergenic
921096306 1:211889733-211889755 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
922604088 1:226878342-226878364 GAGCACCGCACCCAGCCCCAGGG + Intronic
923624572 1:235603523-235603545 GAACACCGTCCCCCTCGCAGGGG + Intronic
1063300344 10:4844952-4844974 GAGCACCGCCCCCTGCTCCATGG - Intronic
1063769748 10:9183671-9183693 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1063848758 10:10161215-10161237 GGGCACTGCCCCCTGCTCAGTGG + Intergenic
1065197067 10:23276796-23276818 GACCACCTCCCTGAGCGCAGGGG + Intronic
1065883880 10:30059650-30059672 GGATACCGCCCTCAGCGCAGAGG - Intronic
1065983800 10:30930093-30930115 GGGCACCGCCCCCTGCTCTGCGG - Intronic
1068211377 10:53924501-53924523 GAGCACCACCCCCTGCTCTGTGG + Intronic
1068863220 10:61867966-61867988 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1070172775 10:73944925-73944947 GAGCACTGCCCCCTGCTCTGCGG + Intergenic
1075968844 10:126635952-126635974 GAGCTCTCCCCTCAGCGCAGAGG + Intronic
1076076337 10:127536944-127536966 GAGCACTGCCTCCAGGGAAGGGG + Intergenic
1076161260 10:128245796-128245818 GAGCACCCTGCCCAGTGCAGGGG - Intergenic
1076619783 10:131779811-131779833 CATCACTGCCCCCAGCACAGAGG + Intergenic
1077253555 11:1571254-1571276 CAGCCCCTCCCCCAGCGCCGCGG + Intronic
1077462176 11:2716066-2716088 GAGCACTGACCCCACCGCCGGGG + Intronic
1077815649 11:5683226-5683248 GAGCACCGCCCCCTGCTCCACGG + Intronic
1079190939 11:18276174-18276196 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1079452210 11:20606921-20606943 GAGCTCAGCCCCTAGCCCAGAGG + Intronic
1079555378 11:21753180-21753202 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1080557643 11:33431782-33431804 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1081329659 11:41788263-41788285 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1082734968 11:56845514-56845536 GAGCACCGCCCCCTGCTCTAAGG + Intergenic
1083856936 11:65397659-65397681 CAGTGCCGCCCCCAGCTCAGCGG - Intronic
1083904664 11:65662145-65662167 GAGCACCTCCCCGACCGCCGCGG + Intronic
1084259176 11:67963545-67963567 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1084393852 11:68896303-68896325 AGGCACCGCCCTCAGAGCAGTGG + Intronic
1086431797 11:86743322-86743344 GAGCACCACCCACAGAGCAGAGG + Intergenic
1087682298 11:101231373-101231395 GAGCACCGCCCCCTGCTCTGTGG - Intergenic
1087962299 11:104366647-104366669 GAGGGGCGCCCACAGCGCAGCGG + Intergenic
1089751326 11:120653428-120653450 GAGCACCGCACTCAGAGCTGAGG - Intronic
1091602766 12:1928061-1928083 GAGCACCGGGCCAAGCCCAGAGG + Intergenic
1091755172 12:3046617-3046639 CAGCACCGCTCCCAGCACATGGG + Intergenic
1092410885 12:8252229-8252251 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1092430488 12:8404550-8404572 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1093189452 12:16057697-16057719 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1094025752 12:25958664-25958686 CAGCCCGGCCCCCAGCCCAGAGG + Intergenic
1094833247 12:34310015-34310037 GAGCACCGCCCTCTGCTCAGTGG + Intergenic
1096263769 12:50108391-50108413 GAGCTCCAACCCCAGAGCAGAGG - Intronic
1098024604 12:66189019-66189041 CAGCTCCGTCCCCACCGCAGAGG + Exonic
1100211834 12:92406556-92406578 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1102826086 12:115948894-115948916 GAGCACTGGCCCCAGGACAGTGG + Intergenic
1103527646 12:121578754-121578776 GCGCTCGGCCCGCAGCGCAGAGG + Intronic
1104195972 12:126538359-126538381 CAGCCCCACCCCCAGCCCAGAGG - Intergenic
1104710156 12:130980018-130980040 GAGCCCGGCCCCCAGACCAGTGG + Intronic
1104841933 12:131829644-131829666 GGGCCCCTCGCCCAGCGCAGTGG + Intronic
1105593925 13:21818226-21818248 GAGCACTGCCCCCTGCCCTGTGG + Intergenic
1108060161 13:46525029-46525051 TAGCACAGGCTCCAGCGCAGGGG + Intergenic
1108435395 13:50396911-50396933 GAGCACCGCCCCCTGCTCCAGGG + Intronic
1108996049 13:56735885-56735907 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
1109446561 13:62447937-62447959 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1112091635 13:96090242-96090264 GAGCGGCCCCCGCAGCGCAGCGG - Intergenic
1113913116 13:113853985-113854007 GTGCATGGCCCCCAGCCCAGAGG + Intronic
1114559766 14:23581068-23581090 GAGCTCTGCCCCCTGCTCAGCGG + Intergenic
1114674251 14:24430234-24430256 GAGCACCGCCCAGGGCCCAGGGG - Intronic
1115119874 14:29927191-29927213 GGGCAGCGCCCCCTGCGCCGCGG + Intronic
1116084441 14:40217235-40217257 GAGGGCCCCCCACAGCGCAGCGG + Intergenic
1116325749 14:43532951-43532973 GAGCAGCTCCCACAGTGCAGCGG - Intergenic
1117449858 14:55839789-55839811 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1118932469 14:70255165-70255187 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
1122254421 14:100466582-100466604 GAGCGCCACCCCGAGGGCAGTGG - Intronic
1122408734 14:101515225-101515247 GAGCACCTCCCACAGCCAAGGGG - Intergenic
1122514582 14:102298011-102298033 GAGCACCGCCCCCTGCTCCAGGG + Intronic
1124626077 15:31308241-31308263 GAGCACAGCCCCCAGGGGAAAGG + Intergenic
1125565706 15:40676965-40676987 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1125874719 15:43133846-43133868 GAGCATGGCCACCAGCGCTGCGG - Exonic
1127640970 15:60915394-60915416 GGGCACAGGCCCCAGTGCAGAGG + Intronic
1128455156 15:67827865-67827887 GCCCAGCGCACCCAGCGCAGGGG + Exonic
1128727224 15:69997259-69997281 GAGCCCCGCCCTCTGCCCAGCGG + Intergenic
1130961317 15:88660302-88660324 GAGTACAGCCCCCAGCACACAGG - Intergenic
1131472785 15:92711097-92711119 GAGCACCGCCCCCTGCTCCAAGG - Intronic
1131846064 15:96491871-96491893 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1131846081 15:96491922-96491944 GCGCACCGCCCCCCGCCCCGGGG - Intergenic
1132419483 15:101652835-101652857 GAGCGCCGGCCCCAGGGGAGGGG - Intergenic
1132469027 16:91555-91577 AAGCACTGCCCCAAGAGCAGGGG + Intronic
1132691131 16:1182431-1182453 GAGCACCGCCCCCAGCGCAGGGG - Intronic
1134109670 16:11507208-11507230 GAGCACAGGCCACAGAGCAGCGG + Intronic
1136636954 16:31529986-31530008 GACCACCGACCCCAACCCAGAGG - Intergenic
1141465697 16:84204653-84204675 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1141564646 16:84893139-84893161 GAGCAGTGTCCCCAGTGCAGCGG - Intronic
1142102931 16:88285197-88285219 GAGAACTGCCCCCAGAGCTGTGG + Intergenic
1142136215 16:88453148-88453170 CGGCTCCGCCCCCAGCGCCGCGG - Intergenic
1142336053 16:89490212-89490234 GACCACCGCCCCCAGACCAGCGG + Intronic
1142413044 16:89925923-89925945 GGGCTCGGCTCCCAGCGCAGGGG - Intronic
1142601674 17:1056118-1056140 GAGAAAAGCCCCCAGGGCAGAGG + Intronic
1143022955 17:3926107-3926129 GAGGACCGCCCCCAGCCCCCAGG + Intronic
1143135226 17:4709130-4709152 GAGCACCGCCCCCTGCTCCAAGG - Intergenic
1144682598 17:17205618-17205640 GAGAACCGCCCCCACCGCGGAGG + Intronic
1145260455 17:21351760-21351782 GAGCAGGGCCCCCAGGCCAGTGG + Intergenic
1149585547 17:57783600-57783622 GAGAACTGCCCCCAACCCAGAGG - Intergenic
1150168361 17:62966214-62966236 GTGCGACGCCCCCAGCGCGGCGG + Intergenic
1150792277 17:68208136-68208158 GAGCACCGCCCCCTGCCCCACGG + Intergenic
1151494238 17:74449917-74449939 GAGCTCTGCCCCCATCTCAGTGG - Intronic
1151674350 17:75589957-75589979 GAGCCCTGCGCCCAGCGCACCGG - Intergenic
1151683489 17:75633917-75633939 GAGCAGCGCTCTCAGGGCAGAGG + Intronic
1152590046 17:81207145-81207167 GAGCACAGCCCCCAGCGAGAAGG - Exonic
1152609771 17:81309855-81309877 GAGCAGGGCCCCCAGCCTAGTGG - Intergenic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1155234849 18:23809065-23809087 GAGCACCTCCCCAAGCACTGGGG + Intronic
1155611665 18:27673927-27673949 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1157232639 18:45933215-45933237 AAGCACTGCCCCCAGGACAGTGG + Intronic
1157476945 18:48029575-48029597 GCCCACCTCGCCCAGCGCAGGGG + Exonic
1159167904 18:64725677-64725699 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1160380168 18:78448470-78448492 GAGCAGAGCCCCCAGGGCAGGGG + Intergenic
1160560629 18:79753753-79753775 GAGCTCCGCCTCCAGCGCCTTGG - Exonic
1160861289 19:1238125-1238147 GAGCCCCGCCCCCGGCCCATCGG + Intergenic
1161040539 19:2108814-2108836 CAGCCCCACCCCCAGAGCAGGGG + Intronic
1162138545 19:8571277-8571299 GAGCCTTGCCCCCAGCTCAGTGG + Intronic
1162373371 19:10291657-10291679 GAGCACCGCGCCCCGCGCTCGGG - Exonic
1163334503 19:16661777-16661799 GACCGCAGCCCCCAGCGCAGTGG - Intronic
1165143496 19:33717038-33717060 GAGGACCTCCCCCAGCCCACCGG - Intronic
1166241585 19:41498479-41498501 GAGCACAGCCTTCAGCACAGAGG + Intergenic
1166275471 19:41750510-41750532 GAACACCGCCCCTGGAGCAGTGG - Intronic
1166304101 19:41928011-41928033 GAGCGCCGCGGCCGGCGCAGGGG - Intronic
1166396247 19:42443473-42443495 GAACACCGCCCCTGGAGCAGTGG + Intergenic
1166920777 19:46227544-46227566 GAGCACCTTCCCCAGGGCAGGGG - Intergenic
1167903392 19:52638510-52638532 CAGCATCGTTCCCAGCGCAGAGG + Intronic
1168408197 19:56121405-56121427 GGCCACCGCCCCCAGCTCTGTGG + Intergenic
924977430 2:191396-191418 GGGCACCGCCCCCTGCTCCGTGG - Intergenic
926743084 2:16128141-16128163 GAACAACGAGCCCAGCGCAGCGG - Intergenic
927640721 2:24843906-24843928 GAGCACTGCCCCCATCCCTGAGG + Intronic
929461185 2:42102811-42102833 GAGATCCGCCCTCAGCGCTGTGG - Intergenic
930468184 2:51780373-51780395 GAGCGCCGCCCCCAGCTCCACGG - Intergenic
931719442 2:65056569-65056591 GGCCACCGCCCCCAGCGCCGCGG - Intronic
933712113 2:85334451-85334473 GAGCACCGCCCCCTGCTCCACGG - Intergenic
935866482 2:107392608-107392630 GAGCGCCGCCCCCTGCTCCGCGG + Intergenic
935896802 2:107747376-107747398 GAGCGCCGCCCCCTGCTCCGGGG - Intergenic
938931168 2:136088108-136088130 GAGCACCGCCCCCTGCTCCACGG - Intergenic
939898962 2:147827182-147827204 GAGCACCGCCCCCTGCTCCACGG + Intergenic
943106114 2:183546716-183546738 GAGCACCGCCCCCTGCTCCACGG - Intergenic
944206677 2:197164500-197164522 GAGCCCTTCCCCCACCGCAGCGG + Intronic
946152716 2:217787303-217787325 GGGCACCGCCCCCTGCTCCGTGG - Intergenic
948712127 2:239831661-239831683 GTGCACCACCCCCAGCCCAGAGG - Intergenic
1168806925 20:676928-676950 GAGCTCAGCCCCCTGCCCAGAGG + Intergenic
1172954848 20:38748743-38748765 GAGCGCAGCATCCAGCGCAGTGG - Exonic
1173572311 20:44085359-44085381 CAGCACAGCTCCCAGGGCAGGGG + Intergenic
1174183357 20:48688834-48688856 GAGCACCAGGCCCAGGGCAGGGG + Intronic
1175244877 20:57575992-57576014 GATAACCACCCCCAGTGCAGAGG - Intergenic
1176173845 20:63708420-63708442 AGGCACAGCTCCCAGCGCAGAGG - Intronic
1177318759 21:19493865-19493887 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1178843556 21:36156737-36156759 CAGCCCCGCCCCAAGCGCCGAGG + Intergenic
1179520703 21:41942626-41942648 GCGCACCTCGCCCAGCACAGAGG + Intronic
1180963983 22:19776177-19776199 GAGCACAGGCCCCAGAGCTGGGG - Intronic
1181025868 22:20127384-20127406 GAGCGGCGCTCACAGCGCAGGGG - Intergenic
1181558556 22:23686317-23686339 GAGCACAGCTCCCAGCTCAGGGG + Intergenic
1183619732 22:38965382-38965404 GGGCTCCCCCCCCAGCGCAGAGG - Intronic
1184230368 22:43155433-43155455 GAGCAGCGCCCCCAAAACAGGGG - Intronic
1184704513 22:46201461-46201483 GATCATGGCCCCCAGAGCAGTGG + Intronic
1184747576 22:46465170-46465192 GAGCAGCGGCCCCTGCCCAGGGG + Intronic
1184962349 22:47940664-47940686 GAGCACCTCCCCTGGCTCAGCGG + Intergenic
1185031698 22:48446957-48446979 GAGCACTGCCCACAACACAGAGG + Intergenic
1185038265 22:48490538-48490560 GAGCACCCTCCCCAGCGCCGAGG - Intronic
1185180496 22:49358111-49358133 GAGCACAGGCCCCACGGCAGTGG + Intergenic
1185229071 22:49670239-49670261 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
1185340983 22:50290989-50291011 ACGCACCGGCCCCAGCGCACAGG + Intronic
1185388876 22:50548477-50548499 CCGCACAGCCCCCCGCGCAGAGG + Exonic
950256915 3:11513283-11513305 GAGCACCGCCCCCTGCTCCACGG - Intronic
950503271 3:13377626-13377648 GACCACCACCCTCAGCACAGGGG + Intronic
951185011 3:19702850-19702872 GGGCACCGCCCCCTGCTCCGTGG + Intergenic
956183890 3:66544682-66544704 GAGCGCCGCCCCCTGCTCTGCGG - Intergenic
956195782 3:66651850-66651872 GAGCACCGCCCCCTGCTCCACGG + Intergenic
956430556 3:69181672-69181694 CAGCACTGCCGCCAGCGGAGTGG - Exonic
957056124 3:75444472-75444494 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
958810718 3:98858010-98858032 GAGCACCGCCCCCTGCTCCATGG - Intronic
960120872 3:113947885-113947907 GTGCCCCGCCCCCGGCGCCGGGG - Exonic
960141158 3:114152906-114152928 GAATACCGCCGCGAGCGCAGCGG - Intronic
960669252 3:120140571-120140593 GAGCGCCGCCCCCTGCTCTGCGG + Intergenic
961279966 3:125758663-125758685 GAGCACCGCCCCCTGCTCCATGG - Intergenic
961775174 3:129279148-129279170 GAGCACCGGCCCCCGCTCCGGGG + Intronic
961781928 3:129325487-129325509 GACCACCACCCTCAGCACAGGGG + Intergenic
962383717 3:134916393-134916415 GAGCACCGCCCCCTGCTCCACGG - Intronic
964014352 3:151928233-151928255 GGGCCCCGCCCCCGGAGCAGCGG + Intergenic
964358387 3:155870676-155870698 GAGCGCGGGCCCCAGCGCCGCGG - Exonic
965837420 3:172867105-172867127 GAGCACCGCCCCCTGCTCCACGG + Intergenic
966246029 3:177808980-177809002 GAGCACCGCCCCCTGCTCCACGG - Intergenic
968712670 4:2130380-2130402 CAGCAGGGCCCCCAGCACAGGGG + Intronic
968953819 4:3708223-3708245 CAGCAGAGCCCCCAGCGCAGTGG - Intergenic
968965362 4:3766614-3766636 CAGCGCCGCCGCCAGCGCCGGGG - Exonic
969017744 4:4115677-4115699 GAGCACCGCCCCCTGCTCCACGG + Intergenic
969677272 4:8621016-8621038 GAGCACGCCACCCAGCGCCGGGG - Intergenic
969678224 4:8626654-8626676 GAGCACGCCACCCAGCGCCGGGG - Intergenic
969679180 4:8632292-8632314 GAGCACGCCACCCAGCGCCGGGG - Intergenic
969814971 4:9680163-9680185 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
970691940 4:18630608-18630630 GGGCACCGCCCCCTGCTCTGCGG - Intergenic
971327468 4:25655893-25655915 GAGTACCGCCGCCGGGGCAGGGG + Intronic
971563610 4:28113101-28113123 GAGCACCGCCCCCTGCTCCACGG + Intergenic
971905143 4:32716262-32716284 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
972344692 4:38182893-38182915 GAGCTCCGCCCCCTGCTCTGCGG + Intergenic
972890514 4:43551535-43551557 GAGCACCGCCCCCTGCTCCGCGG + Intergenic
973878157 4:55241779-55241801 GAGCACCGCCCCCTGCTCCACGG + Intergenic
974781697 4:66561529-66561551 GAGCACCGCCCCCTGCTCCACGG - Intergenic
976226374 4:82798208-82798230 GCGCACCGCCCGCAGCCGAGGGG + Intronic
977206574 4:94170168-94170190 GAGCGCCGCCCCCTGCTCAATGG + Intergenic
977906528 4:102483452-102483474 GAGCACCGCCCCCTGCTCCATGG + Intergenic
980228031 4:130013103-130013125 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
981033688 4:140151066-140151088 CAGCACCCCTCCCAGCCCAGCGG + Intronic
981176541 4:141689895-141689917 GAGCACCGCCCCCTGCTCCACGG - Intronic
984770615 4:183433468-183433490 GAGCACCGCCCCCTGCTCCATGG + Intergenic
984862532 4:184253264-184253286 CGGCACCGCCCCCTGCTCAGGGG + Intergenic
985550605 5:531636-531658 GAGCACCCCCCGCAGAGCAAGGG + Intergenic
985590930 5:764682-764704 GAGCACCGTCCCCTGCTCTGCGG + Intronic
986626223 5:9725651-9725673 GAGCACCGCCCCCTGCTCCACGG + Intergenic
987315342 5:16718275-16718297 GAGCACCGCCCCCTGCTCCACGG + Intronic
988883644 5:35531951-35531973 GAGCACCGCCCCCTGCTCCATGG + Intergenic
991407237 5:66312063-66312085 AAGCAGCTCACCCAGCGCAGTGG - Intergenic
995326373 5:110894064-110894086 GAGCACCGCCCCCTGCTCCAAGG - Intergenic
997760609 5:136444538-136444560 GAGCACCGCCCCCTGCTCCATGG + Intergenic
999042240 5:148427409-148427431 CAGCACCACCGCCAGCACAGTGG + Exonic
999855235 5:155586789-155586811 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1000996928 5:167968878-167968900 TAGCACCGCCCCTTGCACAGGGG - Intronic
1001824662 5:174735406-174735428 GAGCGGTGCGCCCAGCGCAGGGG + Intergenic
1001902595 5:175444234-175444256 GAGGACCGCCCCCAGGGCAGGGG - Intergenic
1002251156 5:177930275-177930297 GAGCACCTGCCCGAGGGCAGAGG + Intergenic
1002327100 5:178416799-178416821 GCACACAGCCCCCAGGGCAGGGG + Intronic
1002516426 5:179762338-179762360 GAGCTCCTCTCCCAGAGCAGAGG + Intronic
1002754727 6:148279-148301 GCGCCCCACCCCCAGCACAGGGG - Intergenic
1002932847 6:1646305-1646327 GAGCACGGACCCCAGAGCAGGGG - Intronic
1002934147 6:1657325-1657347 AAGCACCGCTTCCAGCACAGAGG - Intronic
1003069721 6:2936142-2936164 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
1003983923 6:11417033-11417055 GGGCACCGCCCCCTGCTCCGTGG - Intergenic
1004196537 6:13511072-13511094 GAGCGCCGCCCCCTGCTCCGTGG - Intergenic
1004196770 6:13512465-13512487 GAGGAGCGCCCACAGCGCAGCGG - Intergenic
1004270881 6:14193854-14193876 AAGCACCCCACCCAGCACAGTGG - Intergenic
1005042225 6:21609936-21609958 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1005166145 6:22923359-22923381 GAGCAGTGACACCAGCGCAGGGG - Intergenic
1006071201 6:31498967-31498989 GAGATCCGCCCCCAGCACCGGGG - Intronic
1006135967 6:31896957-31896979 CAGCAGCGCCCCCATCTCAGCGG + Exonic
1007341282 6:41192862-41192884 CAGCACCACCCCAAGCACAGTGG + Exonic
1007620880 6:43213730-43213752 GAGCCTGGGCCCCAGCGCAGTGG + Exonic
1008332361 6:50260159-50260181 GTGCACCTCCACCAGAGCAGTGG + Intergenic
1008572478 6:52829220-52829242 GGGCACCGCCCCCTGCTCCGTGG - Intergenic
1008587801 6:52964966-52964988 CAGCACTGGGCCCAGCGCAGTGG + Intergenic
1009872317 6:69467534-69467556 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1009971331 6:70628131-70628153 GAGGAGCCCCCACAGCGCAGAGG + Intergenic
1011338309 6:86284855-86284877 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1011620054 6:89234525-89234547 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1012598904 6:101070584-101070606 GAGCACTGCCCCCTGCTCCGTGG + Intergenic
1014507809 6:122280904-122280926 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1017488987 6:154927635-154927657 GAGCACAGGACCCAGTGCAGAGG - Intronic
1021006221 7:15397442-15397464 GAGGGCCCCCCACAGCGCAGCGG + Intronic
1023815450 7:43946109-43946131 GAGCAGTGACCCCAACGCAGGGG - Intronic
1024301659 7:47891652-47891674 GAGCACTGCCTCCAGCTCACAGG + Intronic
1027411619 7:77925771-77925793 GAGCACCGCACCCGGCCAAGTGG - Intronic
1027778997 7:82499894-82499916 GAGCACCGCCCCCTGCTCCAAGG + Intergenic
1031110009 7:117596433-117596455 GAGCACCGCCCCCTGCTCCACGG + Intronic
1033312383 7:140271381-140271403 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1033529640 7:142248915-142248937 GAGCACTGTCCTCAGCACAGAGG + Intergenic
1034632096 7:152538924-152538946 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1034947451 7:155272152-155272174 AAGCACCTGCCCCAGAGCAGAGG + Intergenic
1035699261 8:1626122-1626144 GAGCACCCGCCACAGGGCAGAGG - Intronic
1035699382 8:1626626-1626648 GAGCACCCACCACAGGGCAGAGG - Intronic
1036260509 8:7235974-7235996 GAGCACCGCCCCCTGCTCCATGG + Intergenic
1036306104 8:7603548-7603570 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1036312546 8:7694530-7694552 GAGCACCGCCCCCTGCTCCATGG + Intergenic
1036356950 8:8051533-8051555 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1037239463 8:16760577-16760599 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1037263796 8:17036854-17036876 GAGCACCACCCCCTGCGCCACGG - Intronic
1037608637 8:20458272-20458294 GAGCACCACCCCCACCGCCCCGG + Intergenic
1041034613 8:53775937-53775959 GAGCACCGCCCCCTGCTCCACGG - Intronic
1045118739 8:99012967-99012989 GGGAACCGCCGCCGGCGCAGCGG + Intergenic
1046251928 8:111643150-111643172 GAGCACCGCCCCCTGCTCCATGG + Intergenic
1046661153 8:116949786-116949808 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
1048112899 8:131487352-131487374 GAGCACCGCCCCCTGCTCCAAGG + Intergenic
1048186843 8:132249695-132249717 GAGCACCGCCCCCTGCTCTGCGG - Intronic
1049280619 8:141742253-141742275 GAGCACAGCCCCCAGCCTAGAGG - Intergenic
1049573260 8:143379295-143379317 GAGCACCCCTCCCTCCGCAGGGG + Exonic
1049944465 9:580808-580830 GAGCACCGCCCCCTGCTCCGCGG - Intronic
1053811991 9:41862435-41862457 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1054618604 9:67325004-67325026 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1055446632 9:76390377-76390399 GAGCATGGCACCCAGCCCAGAGG - Intronic
1055985480 9:82054418-82054440 GAGCACCGCCCCCTGCTCTGCGG - Intergenic
1056551389 9:87655918-87655940 CAGCACTGTGCCCAGCGCAGAGG + Intronic
1056708922 9:88974802-88974824 GACCCCAGCCCCCAGCTCAGGGG - Intergenic
1057220636 9:93256089-93256111 CAGCACAGCCCCCAGCCCAGGGG - Intronic
1057443437 9:95097981-95098003 GACCACCTCCCCCAGCCCGGGGG - Intergenic
1058379526 9:104362939-104362961 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
1059375369 9:113876571-113876593 GAGCACCCCCCCGGGCGCTGCGG + Intronic
1059810668 9:117852348-117852370 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1060137610 9:121172353-121172375 CAGCACCGCACCCAGCCTAGAGG - Intronic
1061778722 9:132983533-132983555 GAACACCGCCTGCAGCACAGAGG - Intronic
1062047057 9:134429199-134429221 GAACAGCGCCCACAGCGCAGGGG + Exonic
1062339955 9:136089514-136089536 TAGCCCCTCCCCCAGCGCTGGGG + Intronic
1185705859 X:2265774-2265796 GAGCACTGTCCCCAGAGCACCGG + Intronic
1185705928 X:2266214-2266236 GAGCACTGTCCCCAGAGCACCGG + Intronic
1185761003 X:2690350-2690372 GAGAAACTGCCCCAGCGCAGAGG + Intergenic
1188242719 X:27809614-27809636 GAGCGCCGCCCCCCGCTCTGCGG + Intronic
1189324043 X:40102461-40102483 GAGCACCCGGCCCAGCGCGGCGG - Intronic
1190045824 X:47111041-47111063 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1190344250 X:49322529-49322551 GAGCGCCCCCCCCAGCGGTGTGG + Intronic
1190346440 X:49341639-49341661 GAGCGCCCCCCCCAGCGGTGTGG + Intronic
1191055054 X:56232615-56232637 GAACACCAGCCCCAGGGCAGGGG - Intronic
1197978801 X:132194408-132194430 GAGCACCGCCACCTGCTCTGCGG + Intergenic
1202272568 Y:23085685-23085707 GAGCACCGCCCCCTGTTCAAGGG - Intergenic
1202293458 Y:23334997-23335019 GAGCACCGCCCCCTGTTCAAGGG + Intergenic
1202425565 Y:24719429-24719451 GAGCACCGCCCCCTGTTCAAGGG - Intergenic
1202445224 Y:24950656-24950678 GAGCACCGCCCCCTGTTCAAGGG + Intergenic