ID: 1132692216

View in Genome Browser
Species Human (GRCh38)
Location 16:1186709-1186731
Sequence TACGTGGCCACCCGTTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132692216_1132692222 6 Left 1132692216 16:1186709-1186731 CCTCCTCAACGGGTGGCCACGTA 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692216_1132692224 12 Left 1132692216 16:1186709-1186731 CCTCCTCAACGGGTGGCCACGTA 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1132692224 16:1186744-1186766 CGGTGAATGTGCCACGGCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 60
1132692216_1132692219 -8 Left 1132692216 16:1186709-1186731 CCTCCTCAACGGGTGGCCACGTA 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1132692219 16:1186724-1186746 GCCACGTAATGCTTCCTGGCCGG 0: 1
1: 0
2: 1
3: 1
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132692216 Original CRISPR TACGTGGCCACCCGTTGAGG AGG (reversed) Intronic
901347345 1:8557602-8557624 TACGTGTCCACCCGTTTACAGGG - Intronic
914486019 1:148110446-148110468 TACGAGGCCAACCTTTCAGGAGG + Exonic
1096254925 12:50057104-50057126 TACGTGGACATCTGTTGCGGGGG + Intergenic
1113816023 13:113171796-113171818 TGCGTGCCCAGCCGCTGAGGAGG - Exonic
1113940761 13:114017575-114017597 TGCGTGGCCACCAGCTCAGGAGG + Intronic
1123084988 14:105713203-105713225 TGAGTGGACTCCCGTTGAGGGGG + Intergenic
1132692216 16:1186709-1186731 TACGTGGCCACCCGTTGAGGAGG - Intronic
1138193014 16:55032063-55032085 AACGTGACCACACGTTGAGTGGG + Intergenic
1155153640 18:23141097-23141119 AGAGTGGCCACCCTTTGAGGAGG + Intronic
1157440111 18:47704494-47704516 TACTGGGCCACCCATTCAGGAGG - Intergenic
1162199477 19:9010266-9010288 TACCTGGCCAGCAGGTGAGGAGG + Intergenic
935025086 2:99269167-99269189 TATGTAGCCACCACTTGAGGAGG + Intronic
942417027 2:175770210-175770232 TAAATGGCCACACGTTGAGTAGG - Intergenic
948758345 2:240172591-240172613 TACGAGGCCACGCTGTGAGGAGG + Intergenic
1181775473 22:25156913-25156935 TACGTGTAAACCTGTTGAGGAGG - Intronic
1184389936 22:44197498-44197520 CACGTGGCCACCATGTGAGGTGG - Intronic
961381108 3:126497102-126497124 GACGTGGTCACCTGTGGAGGAGG - Intronic
968472837 4:789918-789940 GGCGTGGCCACCTGTTGGGGTGG - Intronic
968472864 4:789996-790018 GGCGTGGCCACCTGTTGGGGTGG - Intronic
968472894 4:790072-790094 GGCGTGGCCACCTGTTGGGGTGG - Intronic
968509299 4:988319-988341 CAGGTGGCCACCCTGTGAGGGGG + Exonic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
1017238138 6:152138689-152138711 TAGGTGGCCACATTTTGAGGAGG + Intronic
1019743550 7:2687731-2687753 AACGAGGCCACCAGGTGAGGAGG - Intronic
1022997769 7:35775329-35775351 TCAGTGGCCATCTGTTGAGGTGG + Intergenic
1030714208 7:112789942-112789964 AACGTGGCGCCCAGTTGAGGGGG + Intronic
1035984447 8:4411085-4411107 CAGGTGGCCACACGTGGAGGGGG - Intronic
1060281717 9:122219655-122219677 TTCGTCGCAACCCGGTGAGGTGG + Intronic
1189234453 X:39476779-39476801 TCTGTGGCCACCCTTTGTGGAGG + Intergenic