ID: 1132692219

View in Genome Browser
Species Human (GRCh38)
Location 16:1186724-1186746
Sequence GCCACGTAATGCTTCCTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 77}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132692216_1132692219 -8 Left 1132692216 16:1186709-1186731 CCTCCTCAACGGGTGGCCACGTA 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1132692219 16:1186724-1186746 GCCACGTAATGCTTCCTGGCCGG 0: 1
1: 0
2: 1
3: 1
4: 77
1132692215_1132692219 -5 Left 1132692215 16:1186706-1186728 CCGCCTCCTCAACGGGTGGCCAC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1132692219 16:1186724-1186746 GCCACGTAATGCTTCCTGGCCGG 0: 1
1: 0
2: 1
3: 1
4: 77
1132692209_1132692219 7 Left 1132692209 16:1186694-1186716 CCCGTGGCACCACCGCCTCCTCA 0: 1
1: 0
2: 2
3: 20
4: 291
Right 1132692219 16:1186724-1186746 GCCACGTAATGCTTCCTGGCCGG 0: 1
1: 0
2: 1
3: 1
4: 77
1132692210_1132692219 6 Left 1132692210 16:1186695-1186717 CCGTGGCACCACCGCCTCCTCAA 0: 1
1: 0
2: 4
3: 22
4: 239
Right 1132692219 16:1186724-1186746 GCCACGTAATGCTTCCTGGCCGG 0: 1
1: 0
2: 1
3: 1
4: 77
1132692214_1132692219 -2 Left 1132692214 16:1186703-1186725 CCACCGCCTCCTCAACGGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1132692219 16:1186724-1186746 GCCACGTAATGCTTCCTGGCCGG 0: 1
1: 0
2: 1
3: 1
4: 77
1132692208_1132692219 13 Left 1132692208 16:1186688-1186710 CCGATGCCCGTGGCACCACCGCC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1132692219 16:1186724-1186746 GCCACGTAATGCTTCCTGGCCGG 0: 1
1: 0
2: 1
3: 1
4: 77
1132692207_1132692219 14 Left 1132692207 16:1186687-1186709 CCCGATGCCCGTGGCACCACCGC 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1132692219 16:1186724-1186746 GCCACGTAATGCTTCCTGGCCGG 0: 1
1: 0
2: 1
3: 1
4: 77
1132692205_1132692219 25 Left 1132692205 16:1186676-1186698 CCTGGCTCGGTCCCGATGCCCGT 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1132692219 16:1186724-1186746 GCCACGTAATGCTTCCTGGCCGG 0: 1
1: 0
2: 1
3: 1
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132692219 Original CRISPR GCCACGTAATGCTTCCTGGC CGG Intronic
900002334 1:21591-21613 GCCACGGGAGGCTCCCTGGCAGG - Intergenic
900022053 1:192115-192137 GCCACGGGAGGCTCCCTGGCAGG - Intergenic
903770322 1:25759638-25759660 GCCAGGTAATGCTTTGAGGCTGG - Intronic
905745697 1:40415452-40415474 ACCACGTCATGCTTCCTTGGTGG + Intronic
907451712 1:54549659-54549681 GCCTCGTGTTGCTCCCTGGCTGG - Intronic
911733328 1:101311944-101311966 GCCACCTTTTGCTTCCTGCCTGG + Intergenic
912286042 1:108370397-108370419 GCCACGGGATGCTCCCTGGAGGG + Intergenic
916838738 1:168577714-168577736 GCCACATGTTGCTACCTGGCTGG + Intronic
920624152 1:207579698-207579720 GCAACATAAGGGTTCCTGGCAGG - Intronic
922797671 1:228348954-228348976 GCCAAGGAATGCTTCCTTCCCGG - Intronic
924569505 1:245225530-245225552 GCCATGTAATGATTCCTGTTGGG + Intronic
1063968205 10:11363168-11363190 GCCAGGAAAGGCTTCCTGGATGG - Intergenic
1066656823 10:37704662-37704684 GCCAGGCACTGCTTCCTGCCAGG + Intergenic
1067791524 10:49292027-49292049 GCTGCGTAATGCTGCATGGCAGG + Intergenic
1068747020 10:60544211-60544233 CCCACTTAATGTGTCCTGGCAGG + Intronic
1074917738 10:117973804-117973826 GCCACAACATGCTTCCTGGAGGG - Intergenic
1083669584 11:64292422-64292444 GCCTCGCCCTGCTTCCTGGCTGG - Intronic
1091375752 12:23653-23675 GCCACGGGAGGCTCCCTGGCAGG - Intergenic
1092755541 12:11759731-11759753 TCTACCTAATGCTTTCTGGCAGG + Intronic
1100409604 12:94302172-94302194 GCCACATAGTGCTTCCTGATGGG + Intronic
1100426908 12:94495890-94495912 CCCAAGTGATCCTTCCTGGCCGG - Intergenic
1104738106 12:131152414-131152436 AGTACTTAATGCTTCCTGGCGGG + Intergenic
1106789894 13:33144023-33144045 GGCAAGTACTGCTTCGTGGCAGG - Intronic
1113338587 13:109400422-109400444 GCCAAGTTCTGCCTCCTGGCTGG - Intergenic
1118925189 14:70185572-70185594 GCCACCTACAGCTTCCTGGTCGG - Intronic
1121177246 14:91899738-91899760 CCCACGTAAAGCTTACTGTCTGG - Intronic
1124795221 15:32771671-32771693 GCCACTTAAAGCCTGCTGGCAGG + Exonic
1126578112 15:50217490-50217512 GCCAGGTTATGCTTGCAGGCAGG + Intronic
1129314458 15:74732793-74732815 GCCAGGTAAGGCTTCCTGGCTGG - Intergenic
1130297201 15:82655812-82655834 GCCAGGTGATGCAGCCTGGCTGG + Intergenic
1131063161 15:89416843-89416865 GCGAAGTAAAGCTGCCTGGCGGG + Intergenic
1131505805 15:93017715-93017737 AGAACGTAATGCTTCCAGGCAGG - Intronic
1132451178 15:101969348-101969370 GCCACGGGAGGCTCCCTGGCAGG + Intergenic
1132692219 16:1186724-1186746 GCCACGTAATGCTTCCTGGCCGG + Intronic
1133434620 16:5768463-5768485 GCCACGTACCCCTTCCTGACAGG - Intergenic
1136060685 16:27724247-27724269 CCCACTCAGTGCTTCCTGGCAGG + Intronic
1144757044 17:17686158-17686180 GCTCAGAAATGCTTCCTGGCAGG + Intronic
1156994245 18:43447304-43447326 GCCAGGTAAGGCCTACTGGCCGG + Intergenic
1159009153 18:63041771-63041793 GCCAGCCACTGCTTCCTGGCAGG + Intergenic
1160064317 18:75561017-75561039 GCCTCGTAATTGTTCCAGGCTGG + Intergenic
1160107436 18:75991126-75991148 GCCGCAGAATGCTTCCTGGAAGG - Intergenic
1160634086 19:63199-63221 GCCACGGGAGGCTCCCTGGCAGG - Intergenic
1160812234 19:1017835-1017857 CCCAGGTAGTGTTTCCTGGCTGG - Intronic
1167465117 19:49646538-49646560 GCCACGGACAGCTTCCTCGCAGG + Exonic
928425045 2:31170911-31170933 GCCAGGGGAGGCTTCCTGGCAGG - Intergenic
929620653 2:43350753-43350775 CACATGAAATGCTTCCTGGCTGG - Intronic
936567393 2:113591829-113591851 GCCACGGGAGGCTCCCTGGCAGG + Intergenic
941687011 2:168456980-168457002 GCCACGCAAGGCTGCCAGGCAGG + Intronic
946182543 2:217957211-217957233 TCCATGTAAGGCTGCCTGGCTGG - Intronic
948365043 2:237449262-237449284 GGCACAGCATGCTTCCTGGCTGG - Intergenic
948884425 2:240875709-240875731 GCCACCCACTGCCTCCTGGCTGG + Intronic
1174375507 20:50124137-50124159 GCCTCGTGGTGTTTCCTGGCTGG - Exonic
1175972442 20:62693519-62693541 GCCAGTGAATGCCTCCTGGCAGG + Intergenic
1176522504 21:7835105-7835127 GCCACTGAATGCTGCCTGACTGG + Intergenic
1176887269 21:14271815-14271837 GGCACGTCATCCTTTCTGGCTGG - Intergenic
1178656524 21:34465117-34465139 GCCACTGAATGCTGCCTGACTGG + Intergenic
953993818 3:47504290-47504312 GCCACGTGTTGCTTCCGGGCTGG + Intronic
954376493 3:50196615-50196637 GCCAGGTACTTCTTCCTGGGAGG - Intergenic
956112979 3:65889785-65889807 GTCAGGTAAGGCTTCCTGGAGGG + Intronic
960968694 3:123123883-123123905 GCCAGGTCATGATTCCCGGCTGG + Intronic
982839067 4:160159703-160159725 GCCACGAGTGGCTTCCTGGCTGG + Intergenic
984527978 4:180880193-180880215 GCCTGGAAATGCATCCTGGCTGG + Intergenic
990174648 5:53093417-53093439 GCCAGGTGATTCTTCCTTGCAGG + Exonic
992080962 5:73234019-73234041 GCCCCGTAATCCTCCCTGGTCGG + Intergenic
992780819 5:80125345-80125367 GCCAAGAAATGCTTCCTAGAGGG + Intronic
993306092 5:86277159-86277181 GCCACGGGATGCTCCCTGGAGGG + Intergenic
999297053 5:150466225-150466247 TCCACGGGATGCTTCCAGGCTGG - Intergenic
1001423739 5:171609229-171609251 TCCAGGGAAGGCTTCCTGGCTGG - Intergenic
1002874539 6:1199759-1199781 GCCAAGTTGTGCTCCCTGGCTGG - Intergenic
1029714490 7:102318579-102318601 GCCAGGAAATCCGTCCTGGCAGG - Intronic
1033424594 7:141232725-141232747 GCCAGGGAAAGCTTTCTGGCAGG - Intronic
1033431844 7:141296362-141296384 GGAAAGTACTGCTTCCTGGCCGG - Intronic
1034031732 7:147774147-147774169 GGCACTTAATGCTATCTGGCAGG + Intronic
1035667554 8:1390026-1390048 GCCTGGAAATGCTTCCAGGCAGG + Intergenic
1037999921 8:23382800-23382822 ACTCCGTAATGCTTCCTGCCTGG + Intronic
1038827008 8:31014838-31014860 CTCACTTTATGCTTCCTGGCTGG - Intronic
1040879955 8:52193565-52193587 GACAGGTACTGCTCCCTGGCAGG + Intronic
1049685337 8:143937147-143937169 GCCAGGTAAGGCTGCCCGGCAGG - Exonic
1049885140 9:21704-21726 GCCACGGGAGGCTCCCTGGCAGG - Intergenic
1186799584 X:13079439-13079461 GCCAGGCAGTGCTTGCTGGCAGG - Intergenic