ID: 1132692222

View in Genome Browser
Species Human (GRCh38)
Location 16:1186738-1186760
Sequence CCTGGCCGGTGAATGTGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 88}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132692216_1132692222 6 Left 1132692216 16:1186709-1186731 CCTCCTCAACGGGTGGCCACGTA 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692209_1132692222 21 Left 1132692209 16:1186694-1186716 CCCGTGGCACCACCGCCTCCTCA 0: 1
1: 0
2: 2
3: 20
4: 291
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692214_1132692222 12 Left 1132692214 16:1186703-1186725 CCACCGCCTCCTCAACGGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692208_1132692222 27 Left 1132692208 16:1186688-1186710 CCGATGCCCGTGGCACCACCGCC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692220_1132692222 -10 Left 1132692220 16:1186725-1186747 CCACGTAATGCTTCCTGGCCGGT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692215_1132692222 9 Left 1132692215 16:1186706-1186728 CCGCCTCCTCAACGGGTGGCCAC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692207_1132692222 28 Left 1132692207 16:1186687-1186709 CCCGATGCCCGTGGCACCACCGC 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692210_1132692222 20 Left 1132692210 16:1186695-1186717 CCGTGGCACCACCGCCTCCTCAA 0: 1
1: 0
2: 4
3: 22
4: 239
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692217_1132692222 3 Left 1132692217 16:1186712-1186734 CCTCAACGGGTGGCCACGTAATG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132692222 Original CRISPR CCTGGCCGGTGAATGTGCCA CGG Intronic
900498421 1:2987498-2987520 CCAGGCCCTTGAATATGCCAGGG + Intergenic
902466196 1:16620184-16620206 CCAGGGCCGTGAAAGTGCCAAGG + Intergenic
902508494 1:16953119-16953141 CCAGGGCCGTGAAAGTGCCAAGG - Intronic
904823606 1:33260386-33260408 CCTGGTGGGGGAATGTGCAAAGG - Intronic
906211578 1:44015269-44015291 CCTGGACGGTGACTGTGCTCTGG + Intronic
906688125 1:47775530-47775552 CATGGCAGGAGAAAGTGCCAGGG + Intronic
906800062 1:48729354-48729376 CGTGGGTGGTGAATGTACCACGG + Intronic
914332682 1:146686987-146687009 CTTGGACAGAGAATGTGCCAAGG + Intergenic
917178071 1:172261628-172261650 CCTGGGCAGTGGATGTGGCATGG + Intronic
919761355 1:201100055-201100077 CCTGCCTGGGGAATGTGCCCAGG - Intronic
1067744852 10:48928160-48928182 CTTGGCAGGGAAATGTGCCAGGG + Intronic
1070154314 10:73824310-73824332 CCTGGCAGGTGCAGGTGCCCAGG + Intronic
1070313104 10:75287891-75287913 CCTGGACAGTGAATGGTCCAGGG - Intergenic
1073096885 10:100985288-100985310 CCTGGCCCCTGAAAGTGCCCCGG - Exonic
1076816910 10:132919593-132919615 CCTGGCGGGTGCATGTCCCAGGG + Intronic
1081706208 11:45183116-45183138 CCTGGCTGGTGAGTGTGCCCTGG + Exonic
1082027530 11:47583883-47583905 TCTGGACTGTGAATATGCCAAGG + Intronic
1089189146 11:116641644-116641666 CCAGGCAGGTGTATGTGCCAGGG - Intergenic
1090640329 11:128724337-128724359 CCAGGCCAGTGAGAGTGCCACGG + Intronic
1094397375 12:30022690-30022712 CCTGGCATGTGGATGTGACAGGG - Intergenic
1096110646 12:49027185-49027207 ACTGGCAGGAGAAGGTGCCAAGG + Exonic
1100142891 12:91640541-91640563 GCTGGCAGGTGAGTGTGGCAAGG + Intergenic
1107878351 13:44810167-44810189 ACTAGCTGGAGAATGTGCCAGGG - Intergenic
1117582690 14:57168927-57168949 CCTGGGTGGTGAATGTGACAAGG - Intergenic
1123765910 15:23478166-23478188 CCTGGCCAGGGGATGTGGCAGGG - Intergenic
1124402129 15:29357922-29357944 CCAGTCTGGTGAGTGTGCCACGG - Intronic
1130696592 15:86137736-86137758 CCTGCCCAGGGAATGGGCCATGG - Intergenic
1131280139 15:91014369-91014391 CATTGCCAGTGAGTGTGCCATGG - Exonic
1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG + Intronic
1138198984 16:55075043-55075065 CATGGCCGGTGAAGGAGCAAGGG + Intergenic
1140000932 16:71024254-71024276 CTTGGACAGAGAATGTGCCAAGG - Intronic
1141638950 16:85329999-85330021 CCTGGCAGGGGCATCTGCCAGGG - Intergenic
1151746303 17:76013675-76013697 CCTGGCCGGGGAAGGGACCATGG - Intronic
1153431581 18:5023196-5023218 GCTGGCAGGTGAATGTACGAAGG + Intergenic
1154059492 18:11046413-11046435 CCTGGCTGTTGAATGAGCCGGGG + Intronic
1157593164 18:48848265-48848287 CTGGGCCGGTGGATGAGCCAGGG - Intronic
1159390645 18:67788447-67788469 CCAGGCTGGAGAATGTGCAAGGG - Intergenic
1161479858 19:4505029-4505051 CCAGGACTGTGAATGTGCCCAGG - Intronic
1162082233 19:8225086-8225108 CCAGGCAGGTGAATTTCCCAGGG + Intronic
1163906241 19:20151580-20151602 CCTGCGCGGTGACTGTGCCCTGG - Intergenic
1166518843 19:43465756-43465778 CCTGCCCTGTGAAGTTGCCAAGG + Intergenic
1167466621 19:49653698-49653720 CCTGGCCTGTGAGTGTCCCCTGG + Exonic
1167745265 19:51347040-51347062 CCTGGGAGGCGAATGTGCCCTGG + Exonic
1167756744 19:51417530-51417552 GCTGGGCGGTGAGTGGGCCAAGG - Exonic
1167942445 19:52958576-52958598 CATGGCAGTTGAGTGTGCCAAGG + Intronic
925497024 2:4462832-4462854 CATGGCCTGTGCATGAGCCATGG + Intergenic
927488424 2:23504842-23504864 TCTGGCCGTTGAATGTGCCCAGG + Intronic
928073788 2:28244067-28244089 CCTGACCTCTGAATGGGCCAAGG - Intronic
929810488 2:45185348-45185370 CTTCTCTGGTGAATGTGCCAGGG - Intergenic
930092639 2:47542311-47542333 CCTGGGCTGTGCATGTGCCAGGG - Intronic
935192778 2:100792208-100792230 CCAGGCCGATGAAACTGCCAAGG + Intergenic
943325400 2:186491456-186491478 CCTGGCAAGTAACTGTGCCAGGG + Intronic
945494129 2:210489538-210489560 GCTAGCAGGTGTATGTGCCAGGG - Intronic
947980928 2:234409193-234409215 CCAGGCAGGTGAATGAGCCTGGG + Intergenic
948947829 2:241230097-241230119 TCAGGCCGGTGGACGTGCCAGGG + Intronic
1168774900 20:439247-439269 CCTGGACTGTGACTGTGACATGG - Exonic
1168851379 20:979308-979330 CCTTGCGGGTGAATGTGGGAAGG - Intronic
1172123057 20:32609726-32609748 CCTGGCTGGTGCCTCTGCCAGGG + Intergenic
1172670229 20:36630065-36630087 CCAGGCCAGAGAATGGGCCAGGG + Intronic
1175083724 20:56442081-56442103 CCAAGCCTGTGAATTTGCCATGG - Intronic
1179608292 21:42532553-42532575 CCTGGCTTCTGAAGGTGCCAAGG + Intronic
1179693130 21:43095391-43095413 CGTGGCCGCTTAGTGTGCCAGGG - Intronic
1181052094 22:20242745-20242767 CCAGGCCGTGGAATGTGGCAGGG + Exonic
1184614020 22:45625693-45625715 CCTGGCCGGTGAAGAGGGCAAGG - Intergenic
949896503 3:8770763-8770785 CCTGACCGGTGAATGTGAGAAGG + Intronic
950811880 3:15657012-15657034 GCTGCCCTGTCAATGTGCCAGGG - Intergenic
954105833 3:48409493-48409515 CATGGCCGATGAATGTGCTGGGG + Intronic
960417068 3:117397838-117397860 CCTGGCCTGTGAGTGTGCAGGGG - Intergenic
961270019 3:125681385-125681407 CCAGGCAGGTGTAGGTGCCATGG - Intergenic
971616034 4:28791635-28791657 CCTGGCCTAGGAAGGTGCCATGG - Intergenic
986546793 5:8906461-8906483 CCTGGCCTGTCACAGTGCCAGGG - Intergenic
991135841 5:63180821-63180843 CCTGGCTGCTGAATGTTCCCAGG - Intergenic
996065119 5:119071250-119071272 CCTGGCCGGTGAGTCGGCCCCGG + Intronic
1000233849 5:159339567-159339589 ACTGGCTGGTGACAGTGCCAAGG - Intergenic
1002132784 5:177091735-177091757 CCAGGCAGGTGTATGTGCCGCGG - Exonic
1002567683 5:180120843-180120865 CCTGGCCGGTGGATCTGGCCTGG + Intronic
1002674251 5:180897506-180897528 CCAGGCCGCTTTATGTGCCAAGG + Intergenic
1018258981 6:161950651-161950673 CCTGGCCTGTGAACTTGCTAAGG + Intronic
1019073883 6:169371313-169371335 GCTGGCAGGTGAAGGTCCCAGGG + Intergenic
1019426046 7:977367-977389 CCTGGCCAGTGATTGTGAAATGG - Intergenic
1024771510 7:52729207-52729229 TCTGGCTGGAGATTGTGCCAAGG - Intergenic
1025777902 7:64575057-64575079 CCTGCGCGGTGACTGTGCCATGG + Intergenic
1026968734 7:74455221-74455243 CTTGGATGGAGAATGTGCCAAGG + Intronic
1036063216 8:5348882-5348904 CCTGGCCAGTTAATGTTTCAAGG + Intergenic
1041133875 8:54735210-54735232 CATGGCCTGTGAAGATGCCAAGG - Intergenic
1047285274 8:123482409-123482431 CTTGGCCCATGAGTGTGCCATGG - Intergenic
1047712299 8:127564604-127564626 CATGGCCTGTGCATGTGCCTTGG + Intergenic
1049093619 8:140535015-140535037 CCTGGCCAGTGATTGCGCGAGGG + Intronic
1049640299 8:143712232-143712254 CATGGCCAGTGCATGTGCCAGGG + Intronic
1058370226 9:104258023-104258045 CATGGATGGTGAATGAGCCAAGG + Intergenic
1062398993 9:136364258-136364280 CCGGGCCGGTGGGTGTGCCCTGG + Exonic
1186096666 X:6109957-6109979 CCTGACTGGTTAATGTGCCTGGG + Intronic
1189631805 X:42961958-42961980 CCTGGCTGATGAAACTGCCAGGG - Intergenic
1192847804 X:74924499-74924521 CCTGGCCAGGGAATGGGGCATGG - Intronic
1194049298 X:89048959-89048981 AGTGGCCTGTGATTGTGCCATGG - Intergenic
1196829335 X:119763860-119763882 CCTGGAGGATGAATGTGCCAGGG + Intergenic
1198279873 X:135131141-135131163 ACAGGCAGGTGAATGTGGCAAGG - Intergenic
1198291084 X:135241373-135241395 ACAGGCAGGTGAATGTGGCAAGG + Intergenic
1201430415 Y:13896905-13896927 CCAGGCCAGTAAAAGTGCCAGGG - Intergenic