ID: 1132692222

View in Genome Browser
Species Human (GRCh38)
Location 16:1186738-1186760
Sequence CCTGGCCGGTGAATGTGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 88}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132692215_1132692222 9 Left 1132692215 16:1186706-1186728 CCGCCTCCTCAACGGGTGGCCAC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692216_1132692222 6 Left 1132692216 16:1186709-1186731 CCTCCTCAACGGGTGGCCACGTA 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692207_1132692222 28 Left 1132692207 16:1186687-1186709 CCCGATGCCCGTGGCACCACCGC 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692217_1132692222 3 Left 1132692217 16:1186712-1186734 CCTCAACGGGTGGCCACGTAATG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692214_1132692222 12 Left 1132692214 16:1186703-1186725 CCACCGCCTCCTCAACGGGTGGC 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692209_1132692222 21 Left 1132692209 16:1186694-1186716 CCCGTGGCACCACCGCCTCCTCA 0: 1
1: 0
2: 2
3: 20
4: 291
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692220_1132692222 -10 Left 1132692220 16:1186725-1186747 CCACGTAATGCTTCCTGGCCGGT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692208_1132692222 27 Left 1132692208 16:1186688-1186710 CCGATGCCCGTGGCACCACCGCC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88
1132692210_1132692222 20 Left 1132692210 16:1186695-1186717 CCGTGGCACCACCGCCTCCTCAA 0: 1
1: 0
2: 4
3: 22
4: 239
Right 1132692222 16:1186738-1186760 CCTGGCCGGTGAATGTGCCACGG 0: 1
1: 0
2: 0
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132692222 Original CRISPR CCTGGCCGGTGAATGTGCCA CGG Intronic