ID: 1132692460

View in Genome Browser
Species Human (GRCh38)
Location 16:1187687-1187709
Sequence GGTCAGAGTGGCCCCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132692460_1132692466 10 Left 1132692460 16:1187687-1187709 CCTGCTTGGGGGCCACTCTGACC 0: 1
1: 0
2: 2
3: 21
4: 178
Right 1132692466 16:1187720-1187742 AGCCAGGCAGCAGCCGCACCTGG 0: 1
1: 0
2: 2
3: 38
4: 387
1132692460_1132692464 -6 Left 1132692460 16:1187687-1187709 CCTGCTTGGGGGCCACTCTGACC 0: 1
1: 0
2: 2
3: 21
4: 178
Right 1132692464 16:1187704-1187726 CTGACCATAGAGGAGGAGCCAGG 0: 1
1: 1
2: 0
3: 34
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132692460 Original CRISPR GGTCAGAGTGGCCCCCAAGC AGG (reversed) Intronic
900720979 1:4175671-4175693 GGTCTGGGGGGCCTCCAAGCTGG - Intergenic
900882624 1:5392945-5392967 GGTCAGGGTGGATCCCATGCTGG + Intergenic
901416006 1:9117364-9117386 GCTCAGGGTGGCCCCCTGGCTGG - Intronic
901449970 1:9329970-9329992 GTTCAGAGTGGCCCAGGAGCAGG + Intronic
901973867 1:12929418-12929440 GGGCACAGTGGCCCCATAGCTGG - Intronic
902011311 1:13272350-13272372 GGGCACAGTGGCCCCATAGCTGG + Intergenic
902631229 1:17705792-17705814 GTTCTGTGTGGCCCCCCAGCTGG + Intergenic
902636170 1:17736400-17736422 TGTCAGAGTTTCACCCAAGCTGG - Intergenic
902770949 1:18645359-18645381 GATCAAAGAGGCCCCCGAGCGGG + Intronic
905581325 1:39084438-39084460 GGTAAGAGAGGTCCCCCAGCAGG + Exonic
908253388 1:62282971-62282993 GCTGAGAGTGGCCGCCAAGGAGG + Intronic
909608797 1:77532208-77532230 GGCCAGAGTGGGCGCCAAGGCGG + Intronic
912421266 1:109543822-109543844 GGTCTGGGGGGCCCCCGAGCTGG - Exonic
914373475 1:147051321-147051343 GGGAAGAGTGGTCCCCACGCTGG - Intergenic
915269491 1:154743420-154743442 GCTCAGAGAGGCCCCCAGGTTGG - Intronic
915537242 1:156544252-156544274 AGTGAGGGTGGGCCCCAAGCTGG - Intronic
916640084 1:166718070-166718092 GGTCAGACTGGACCCCAAAGGGG + Intergenic
917362647 1:174194082-174194104 GGTCAGTGTTGACCCCATGCTGG - Intronic
920949185 1:210556601-210556623 GCCCAGAGTGGCCTCCAAGAGGG + Intronic
1062868650 10:879296-879318 GGTCAGAGTATCCCCCATCCTGG + Intronic
1062925377 10:1312341-1312363 GGTCAGAGTGAGCCCCCGGCAGG + Intronic
1064694136 10:17948916-17948938 TATCAGAGTGGCCGCCTAGCAGG + Intergenic
1065814221 10:29470063-29470085 CCTCAGAGCGGCCCCCAAGTCGG + Intronic
1067558514 10:47288466-47288488 AGTCAGAGGGGCTCCCAGGCAGG + Intergenic
1067569566 10:47361434-47361456 GGCCAGAGTAGCCCCCAGGCCGG - Intergenic
1070807084 10:79276929-79276951 GGTCAGAATGGCCCGCGTGCAGG - Intronic
1074134497 10:110615027-110615049 AGACAGAAAGGCCCCCAAGCTGG + Intergenic
1074214678 10:111372813-111372835 GGTCAGAGTGGAACCAAAGATGG + Intergenic
1075574902 10:123571168-123571190 GAGCAGAGGGGCCCCCAGGCAGG - Intergenic
1075663529 10:124214850-124214872 TCTCAGAGTGGCCCCCGCGCTGG + Intergenic
1076462569 10:130656638-130656660 AGGCAGAGTGGACCCCGAGCGGG + Intergenic
1076623053 10:131805133-131805155 GGTCTCACGGGCCCCCAAGCGGG + Intergenic
1076756865 10:132577130-132577152 GGGCAGAGGGACCCCCAGGCAGG + Intronic
1077144050 11:1036964-1036986 GGCCAGGATGGCCCCCATGCAGG - Intergenic
1077282757 11:1753061-1753083 GGGCAGAGGGGCCCTCAGGCAGG + Exonic
1078729157 11:13960272-13960294 GGTCTGAGTGACAGCCAAGCTGG + Intergenic
1080786348 11:35478438-35478460 GGGCAGAGTTGGCCCCAAGATGG + Intronic
1080931690 11:36817947-36817969 GGTCAGAGAGGCCCACAGGCAGG + Intergenic
1082035464 11:47642188-47642210 GCTCGGCGAGGCCCCCAAGCGGG + Intronic
1082816520 11:57513429-57513451 TGTGTGAGTGGCCCCGAAGCTGG - Intronic
1083407930 11:62471705-62471727 GGGCTGCCTGGCCCCCAAGCAGG - Intronic
1083938624 11:65883262-65883284 GGACAGAGTGGTCCACAAGCTGG - Exonic
1084963479 11:72730668-72730690 GGACAAAGTGTCCCCCAGGCTGG - Intronic
1085076608 11:73597725-73597747 GGTGAGGGTGGGACCCAAGCAGG - Intronic
1085341630 11:75735217-75735239 GGACAGAGTGGCAACCAAGCTGG + Intergenic
1085500461 11:77017966-77017988 AGACAGAGTCTCCCCCAAGCTGG + Intronic
1089611223 11:119670512-119670534 GGTCCCAGTGGGCCCCATGCAGG - Intronic
1090091581 11:123702875-123702897 GGGGAGAGTGGCCCCAAAGAGGG + Intergenic
1093583342 12:20807914-20807936 GGCCAGAGTGGGCGCCAAGGCGG + Intergenic
1096576804 12:52557888-52557910 GGCCAGAGGGCTCCCCAAGCAGG - Intergenic
1102816517 12:115870385-115870407 GGTCAAAGTGACCCACAAACAGG + Intergenic
1103975700 12:124701240-124701262 GCACAGAGAGGCCCCCAAGGAGG - Intergenic
1104717253 12:131024256-131024278 GGTCAGAGAGGCCCACATGGAGG + Intronic
1105813262 13:24012342-24012364 GGTCAAGGTTGCCCCCAGGCAGG + Intronic
1112756974 13:102646759-102646781 GGTCAGAGTAGCTCCCAGGTGGG + Intronic
1117315520 14:54567529-54567551 GGTCCGAGTTGCCGCCCAGCGGG + Intronic
1121232142 14:92365675-92365697 GGACACTGAGGCCCCCAAGCAGG + Intronic
1122891384 14:104733744-104733766 GGACAGAGTGGGCCCCAAAAGGG + Intronic
1124036301 15:26056788-26056810 GGCCAGAGTGGGCACCAAGGCGG - Intergenic
1125631529 15:41151554-41151576 GGCCAGAGTGGGCGCCAAGGCGG - Intergenic
1128262351 15:66241223-66241245 TGTCACAGTGTCCCCCAAGCTGG + Intronic
1131050703 15:89346095-89346117 AGTCAGAGGGGCCCTCAAGTGGG - Intergenic
1132692460 16:1187687-1187709 GGTCAGAGTGGCCCCCAAGCAGG - Intronic
1134958872 16:18394283-18394305 GGTCAGTGTGGGCCCAAAACGGG + Intergenic
1136578265 16:31137013-31137035 GGCCAGAGTGGCCCTCAAGGAGG - Intergenic
1138199919 16:55080945-55080967 GTTCAGAGAGGCCTCCCAGCTGG - Intergenic
1139280960 16:65770088-65770110 GGTCAGAATGGCCACCCTGCAGG + Intergenic
1139514321 16:67444433-67444455 GCTCAGGGTCGCCCCCCAGCGGG + Intronic
1141504428 16:84465298-84465320 GGTCAGAGTGGACCCCTGCCAGG + Intergenic
1142282037 16:89153767-89153789 GGGCAGAGGGGCCCCCACACCGG - Intronic
1142696548 17:1636981-1637003 GGGCAGCGTGGAGCCCAAGCTGG + Exonic
1143145075 17:4769984-4770006 GGTCTGAGTGGGCCGCAAGGAGG + Intergenic
1143519493 17:7437449-7437471 GGCCAAAGTGGCCCGCAAGGGGG + Exonic
1143670904 17:8395257-8395279 GGTCAATGTGGCCCCCAGGATGG + Intronic
1144625908 17:16844409-16844431 GGGAAGAGAGGCCCCCAGGCAGG - Intergenic
1144880525 17:18428311-18428333 GGGAAGAGAGGCCCCCAGGCAGG + Intergenic
1145238906 17:21228138-21228160 GGAGAGAGTGGCCCCCAGGCAGG - Intergenic
1145900489 17:28487753-28487775 GGTCAAAGTGGCCCCAATCCTGG + Intronic
1146273163 17:31497743-31497765 GGTGACAGTGGCCCCCAAGCAGG + Intronic
1147839862 17:43363610-43363632 GATCAGAGTGGCTCCCAGGCAGG - Intergenic
1150157955 17:62869980-62870002 GCTCTGTGTGGCCCCCAAACAGG + Intergenic
1150599266 17:66636512-66636534 GGTCAGAGTGAAGGCCAAGCTGG - Intronic
1151669877 17:75566172-75566194 GGGCAGAATGGCCCCCGTGCTGG + Intronic
1151955593 17:77378680-77378702 GCTCAGAGGGACCCCCAGGCGGG - Intronic
1151999281 17:77635262-77635284 GGTCACAGTGGCCCAGGAGCTGG + Intergenic
1152701623 17:81822579-81822601 GGTCACAGTGGCCCCTGGGCAGG - Exonic
1155847195 18:30722967-30722989 GTTCTCAGTGGCCTCCAAGCAGG + Intergenic
1157304749 18:46508796-46508818 GCTAAGAGTGGCTCCAAAGCTGG - Intronic
1161507545 19:4652058-4652080 GGTCAAGGTGGCCCTGAAGCTGG + Exonic
1161595057 19:5146909-5146931 GGTCTCAGTGTCACCCAAGCTGG - Intronic
1161619666 19:5291438-5291460 CGTCAGTGTGTCCCCCATGCTGG + Intronic
1162155528 19:8675735-8675757 GGTCTGACTGTCACCCAAGCTGG - Intergenic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1164561523 19:29295565-29295587 GGTCAGAGTGGCCACCCTGCAGG + Intergenic
1165463591 19:35959116-35959138 GGGGAGAGTGGCGCCCACGCAGG - Intergenic
1168274015 19:55266137-55266159 GTTCAGGGTGGCCCACCAGCAGG + Exonic
925370595 2:3342506-3342528 GTGCAGCGTGGCCCCCAAGCTGG + Intronic
927085856 2:19673409-19673431 GGTCAGAGGGGCCCTGAGGCCGG - Intergenic
929050785 2:37834911-37834933 TGTCAGAGTGCCCCCCACCCTGG - Intergenic
930024041 2:47019548-47019570 GGTCAGAGTGGATCACAAGTTGG + Intronic
932460801 2:71880775-71880797 CATCAGAGTGGCCCCAAAGAAGG + Intergenic
935321415 2:101893102-101893124 GGTCAGAGTGGGTGCCAAGTGGG - Intronic
937249488 2:120514648-120514670 GGATGGAGTGGCCCCCATGCGGG + Intergenic
940306090 2:152228164-152228186 GTTCACAGTTGCTCCCAAGCTGG - Intergenic
942334890 2:174872816-174872838 GATCAGAGTAGTCCCCAACCAGG - Intronic
945155587 2:206834130-206834152 GGACAGAGTGGCTGCCAAGAAGG - Intergenic
945227485 2:207546699-207546721 GGTCTCACTGTCCCCCAAGCTGG - Intronic
945926933 2:215815395-215815417 GGTCACAGTTACCCCCAAGATGG + Intergenic
945954361 2:216071866-216071888 TGTCAAAGTGGCACCCAAACGGG - Intronic
946177249 2:217929276-217929298 GGTGAGTGTGGCCCCTGAGCCGG - Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
947522042 2:230853803-230853825 GGTCAAAATCGCCCCCAACCAGG + Intergenic
948155508 2:235778113-235778135 GGACAGAGGGGCCACCCAGCTGG - Intronic
948803997 2:240445296-240445318 GGATAGGGTGGCTCCCAAGCGGG + Intronic
948997718 2:241592185-241592207 GCTCAGAGAGGCCCCCAGCCTGG - Intronic
1169080654 20:2796215-2796237 GGACAGAGTGGCCCTCATGCTGG + Intronic
1169970753 20:11267335-11267357 GGGCAGAGTGCCCCCGAAGGAGG - Intergenic
1171086904 20:22246028-22246050 AGACATAGTGGTCCCCAAGCTGG - Intergenic
1171390632 20:24799469-24799491 GGTCAGCGTGGGTCCCATGCTGG - Intergenic
1174093014 20:48064632-48064654 GGAAAGAGTGGCCCCCTAGCAGG - Intergenic
1175412200 20:58777723-58777745 GGCCAGGCTGGCCCCCAGGCTGG - Intergenic
1176238641 20:64065780-64065802 CCTCTGAGTTGCCCCCAAGCAGG - Intronic
1176871317 21:14084888-14084910 GGGCGGAGTGGCCCGCCAGCTGG + Intergenic
1178662438 21:34518965-34518987 GGCCAGAGCGGCACCCCAGCGGG - Intronic
1181001810 22:19991274-19991296 GGCCAGTGTGGCCAGCAAGCAGG + Intronic
1181671545 22:24427744-24427766 GGGGTGAGTGGCCCCCAGGCGGG + Intronic
1183476835 22:38040253-38040275 GGTCTCACTGGCCCCCAGGCTGG - Intronic
1183704238 22:39467187-39467209 TGACAGAGTGCCCACCAAGCAGG + Intronic
1184149344 22:42629397-42629419 GGTGAGAGTGGCTCCCTAGCAGG - Intronic
949507371 3:4740223-4740245 GGTCAGCCAGGCCCCCAAGCTGG + Intronic
952011712 3:28907170-28907192 TGTCAGAATGGCCACCCAGCAGG + Intergenic
954712954 3:52514010-52514032 GGGCACAGTGTCCCCCGAGCAGG - Intronic
955402224 3:58600554-58600576 GGTCAGCCTGGCTCCAAAGCTGG + Intronic
955751900 3:62191833-62191855 GGTCAGGATGGCGCCCAGGCAGG - Intronic
956442208 3:69291533-69291555 TGTCCCAGTGTCCCCCAAGCAGG - Intronic
959579238 3:107967245-107967267 TGTCAGAGTTGCCCTCAACCTGG - Intergenic
961017653 3:123480072-123480094 GCCCAGCCTGGCCCCCAAGCTGG - Intergenic
961593235 3:127996406-127996428 GCTCAGGATTGCCCCCAAGCTGG + Intergenic
961684811 3:128622444-128622466 GGTCAGAGTGGACCCAAGCCTGG - Intronic
961861356 3:129919008-129919030 GGTCAGAGTGGCTCCCATCAGGG + Intergenic
962049304 3:131795933-131795955 TGTCAGAATGGCCACCATGCAGG + Intronic
962262399 3:133921179-133921201 GTTCATAATGGCCCCCAAACTGG + Intergenic
965604001 3:170481853-170481875 GGTCAGGAGGACCCCCAAGCAGG - Intronic
967040698 3:185689503-185689525 GGGAAGAGTGGTCCCCACGCTGG + Exonic
968359303 3:198136341-198136363 GAGCAGAGTGGCCCCTGAGCGGG - Intergenic
968605242 4:1532293-1532315 GGACAGGGTTGCCCCCCAGCAGG + Intergenic
970656425 4:18235372-18235394 AGTCAGAGTGGCACCCAAGGGGG + Intergenic
973615917 4:52677816-52677838 AGACAGAGTGTCTCCCAAGCTGG + Intergenic
975558055 4:75683644-75683666 GGTCAGAGTGGCAGTCCAGCAGG - Intronic
979867100 4:125770256-125770278 AGTCAGAGTGGTGCCCAGGCTGG + Intergenic
981005002 4:139865772-139865794 GGTCAGAGGAGGACCCAAGCAGG - Intronic
988338341 5:29935899-29935921 GGACAGGGTGTCTCCCAAGCTGG + Intergenic
994647823 5:102491830-102491852 GGCCAGAGTGGGCGCCAAGGCGG + Intronic
995607016 5:113867673-113867695 GTTCAGAGTGCTACCCAAGCAGG - Intergenic
995855350 5:116585899-116585921 GGGCACAGTGTCCACCAAGCTGG + Intergenic
996857569 5:128026947-128026969 GGTTAGAGTGGAAGCCAAGCAGG + Intergenic
998902526 5:146871192-146871214 GGCCAGAGTGGCTCTCCAGCTGG - Intronic
1000200601 5:159006364-159006386 GGACAGAGTGGCCACCACTCTGG - Intronic
1000702911 5:164475060-164475082 GATCAGAATTGCCCCCAAGAGGG + Intergenic
1001534478 5:172488973-172488995 GGTCAGCGTGGGCCCCAGTCTGG + Intergenic
1001648267 5:173297896-173297918 AGACAGAGTGGGCTCCAAGCAGG + Intergenic
1003398646 6:5774090-5774112 GGTCAGAGTGGACCCTGAGGGGG - Intergenic
1003700810 6:8462722-8462744 GGTATGGGTGGCACCCAAGCAGG - Intergenic
1004045425 6:12018370-12018392 GGCCAGAGTGGGCACCAAGGCGG + Intronic
1006833238 6:36981566-36981588 GGTGAGTGTGCCTCCCAAGCAGG - Exonic
1007398983 6:41593072-41593094 GGTCAAAGTGGACCTCAAGCTGG - Intronic
1007915891 6:45561382-45561404 GGGCAGAGGGGGCCCCAAGGAGG + Intronic
1011101742 6:83729607-83729629 GGGCAGAGTGGCCACCAGGATGG - Intergenic
1013225857 6:108119062-108119084 GGTCAAAGTGGCCCCGACTCGGG + Intronic
1018836131 6:167485517-167485539 GGACAGTGTGGGCCCTAAGCAGG - Intergenic
1018908925 6:168090834-168090856 GGACAGAGTAGCCCCCAAGAGGG - Intergenic
1019260691 7:80335-80357 GAGCAGAGTGGCCCCTGAGCGGG + Intergenic
1023856261 7:44185978-44186000 GCTCCAGGTGGCCCCCAAGCAGG - Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1027955973 7:84880446-84880468 GGCCAGAGTGGGCGCCAAGGCGG - Intergenic
1030091606 7:105863276-105863298 GGCCACAGAGGCCCCAAAGCTGG + Intronic
1030980751 7:116182404-116182426 GGCCAGAGTGGGCGCCAAGGCGG + Intergenic
1033033065 7:137846055-137846077 CGTCAAAGTTGCCCCTAAGCAGG - Intronic
1034526106 7:151663667-151663689 GATCAGACTGGCCACTAAGCTGG - Intronic
1038455634 8:27670600-27670622 GGTCAGACTGGCCTCAGAGCAGG + Intronic
1039305528 8:36258308-36258330 GGTCAGAATGGCCACCCTGCAGG - Intergenic
1042207490 8:66343881-66343903 TGTCAGAATGGCCCCCCTGCAGG + Intergenic
1043640094 8:82441299-82441321 GGCCAGAGTGGGCGCCAAGGCGG - Intergenic
1044481863 8:92699819-92699841 GGCCAGAGTGGCCCACAGCCGGG - Intergenic
1047100249 8:121667896-121667918 GGCCAGAGTGGGCGCCAAGGCGG + Intergenic
1047597380 8:126392553-126392575 GGGCAGAGTGGTCACCAAGCAGG - Intergenic
1049575011 8:143385897-143385919 TTTCAGAGTGGTCCCCAGGCAGG + Intergenic
1051259571 9:15249718-15249740 GGTCAGAGGGGAAGCCAAGCAGG + Intronic
1057190218 9:93083130-93083152 TGTCAGAGTGGCCCCTAAGCCGG - Intronic
1057200000 9:93134718-93134740 TGTCAGCGTGGCCCGCAATCAGG - Intergenic
1057221191 9:93258888-93258910 TGTCAGTGTGGGCCCCAACCAGG - Intronic
1057827494 9:98382172-98382194 GGGCAGAGTGGCCCCCGGGAAGG + Intronic
1058733130 9:107869222-107869244 AGTCAGAGAGGCACCCCAGCAGG + Intergenic
1059435164 9:114271670-114271692 GGTCAGAGCGGGGCCCAAGACGG - Intronic
1060175132 9:121492154-121492176 GGCAAGAGAGGCCCCCAAGTTGG + Intergenic
1061231095 9:129316234-129316256 GGGCAGAGTGGCCCATGAGCTGG + Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1062743991 9:138200055-138200077 GAGCAGAGTGGCCCCTGAGCGGG - Intergenic
1185627372 X:1492264-1492286 GGTGAGGGTGGCCCCCTAACTGG - Intronic
1191960283 X:66693119-66693141 GATCAGAGTGGCAGCCAAGATGG - Intergenic
1193588494 X:83357767-83357789 AGCAAGAGTGGCTCCCAAGCAGG + Intergenic
1200239751 X:154487200-154487222 GGTCACCGTGTCACCCAAGCTGG + Intergenic