ID: 1132694184

View in Genome Browser
Species Human (GRCh38)
Location 16:1194740-1194762
Sequence CTCCGTGAGGGTCCCAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 248}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132694184_1132694192 5 Left 1132694184 16:1194740-1194762 CCGGGCCTGGGACCCTCACGGAG 0: 1
1: 0
2: 2
3: 45
4: 248
Right 1132694192 16:1194768-1194790 CCCGGCCAGGCGCAGGCCCCAGG 0: 1
1: 0
2: 7
3: 46
4: 501
1132694184_1132694195 15 Left 1132694184 16:1194740-1194762 CCGGGCCTGGGACCCTCACGGAG 0: 1
1: 0
2: 2
3: 45
4: 248
Right 1132694195 16:1194778-1194800 CGCAGGCCCCAGGCGCCACCTGG 0: 1
1: 0
2: 1
3: 32
4: 277
1132694184_1132694200 29 Left 1132694184 16:1194740-1194762 CCGGGCCTGGGACCCTCACGGAG 0: 1
1: 0
2: 2
3: 45
4: 248
Right 1132694200 16:1194792-1194814 GCCACCTGGTGGCTGCTTTCAGG 0: 1
1: 0
2: 5
3: 19
4: 208
1132694184_1132694196 18 Left 1132694184 16:1194740-1194762 CCGGGCCTGGGACCCTCACGGAG 0: 1
1: 0
2: 2
3: 45
4: 248
Right 1132694196 16:1194781-1194803 AGGCCCCAGGCGCCACCTGGTGG 0: 1
1: 0
2: 6
3: 36
4: 304
1132694184_1132694190 -2 Left 1132694184 16:1194740-1194762 CCGGGCCTGGGACCCTCACGGAG 0: 1
1: 0
2: 2
3: 45
4: 248
Right 1132694190 16:1194761-1194783 AGCAGAGCCCGGCCAGGCGCAGG 0: 1
1: 0
2: 3
3: 37
4: 327
1132694184_1132694189 -8 Left 1132694184 16:1194740-1194762 CCGGGCCTGGGACCCTCACGGAG 0: 1
1: 0
2: 2
3: 45
4: 248
Right 1132694189 16:1194755-1194777 TCACGGAGCAGAGCCCGGCCAGG 0: 1
1: 1
2: 1
3: 19
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132694184 Original CRISPR CTCCGTGAGGGTCCCAGGCC CGG (reversed) Intronic