ID: 1132694185

View in Genome Browser
Species Human (GRCh38)
Location 16:1194745-1194767
Sequence CTCTGCTCCGTGAGGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 211}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132694185_1132694202 27 Left 1132694185 16:1194745-1194767 CCTGGGACCCTCACGGAGCAGAG 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1132694202 16:1194795-1194817 ACCTGGTGGCTGCTTTCAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 217
1132694185_1132694204 28 Left 1132694185 16:1194745-1194767 CCTGGGACCCTCACGGAGCAGAG 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1132694204 16:1194796-1194818 CCTGGTGGCTGCTTTCAGGAGGG 0: 1
1: 0
2: 3
3: 33
4: 322
1132694185_1132694196 13 Left 1132694185 16:1194745-1194767 CCTGGGACCCTCACGGAGCAGAG 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1132694196 16:1194781-1194803 AGGCCCCAGGCGCCACCTGGTGG 0: 1
1: 0
2: 6
3: 36
4: 304
1132694185_1132694192 0 Left 1132694185 16:1194745-1194767 CCTGGGACCCTCACGGAGCAGAG 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1132694192 16:1194768-1194790 CCCGGCCAGGCGCAGGCCCCAGG 0: 1
1: 0
2: 7
3: 46
4: 501
1132694185_1132694200 24 Left 1132694185 16:1194745-1194767 CCTGGGACCCTCACGGAGCAGAG 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1132694200 16:1194792-1194814 GCCACCTGGTGGCTGCTTTCAGG 0: 1
1: 0
2: 5
3: 19
4: 208
1132694185_1132694195 10 Left 1132694185 16:1194745-1194767 CCTGGGACCCTCACGGAGCAGAG 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1132694195 16:1194778-1194800 CGCAGGCCCCAGGCGCCACCTGG 0: 1
1: 0
2: 1
3: 32
4: 277
1132694185_1132694205 29 Left 1132694185 16:1194745-1194767 CCTGGGACCCTCACGGAGCAGAG 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1132694205 16:1194797-1194819 CTGGTGGCTGCTTTCAGGAGGGG 0: 1
1: 0
2: 3
3: 34
4: 266
1132694185_1132694190 -7 Left 1132694185 16:1194745-1194767 CCTGGGACCCTCACGGAGCAGAG 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1132694190 16:1194761-1194783 AGCAGAGCCCGGCCAGGCGCAGG 0: 1
1: 0
2: 3
3: 37
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132694185 Original CRISPR CTCTGCTCCGTGAGGGTCCC AGG (reversed) Intronic