ID: 1132694188

View in Genome Browser
Species Human (GRCh38)
Location 16:1194753-1194775
Sequence TGGCCGGGCTCTGCTCCGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 170}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132694188_1132694204 20 Left 1132694188 16:1194753-1194775 CCTCACGGAGCAGAGCCCGGCCA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1132694204 16:1194796-1194818 CCTGGTGGCTGCTTTCAGGAGGG 0: 1
1: 0
2: 3
3: 33
4: 322
1132694188_1132694205 21 Left 1132694188 16:1194753-1194775 CCTCACGGAGCAGAGCCCGGCCA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1132694205 16:1194797-1194819 CTGGTGGCTGCTTTCAGGAGGGG 0: 1
1: 0
2: 3
3: 34
4: 266
1132694188_1132694206 24 Left 1132694188 16:1194753-1194775 CCTCACGGAGCAGAGCCCGGCCA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1132694206 16:1194800-1194822 GTGGCTGCTTTCAGGAGGGGCGG 0: 1
1: 0
2: 3
3: 35
4: 302
1132694188_1132694192 -8 Left 1132694188 16:1194753-1194775 CCTCACGGAGCAGAGCCCGGCCA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1132694192 16:1194768-1194790 CCCGGCCAGGCGCAGGCCCCAGG 0: 1
1: 0
2: 7
3: 46
4: 501
1132694188_1132694196 5 Left 1132694188 16:1194753-1194775 CCTCACGGAGCAGAGCCCGGCCA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1132694196 16:1194781-1194803 AGGCCCCAGGCGCCACCTGGTGG 0: 1
1: 0
2: 6
3: 36
4: 304
1132694188_1132694195 2 Left 1132694188 16:1194753-1194775 CCTCACGGAGCAGAGCCCGGCCA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1132694195 16:1194778-1194800 CGCAGGCCCCAGGCGCCACCTGG 0: 1
1: 0
2: 1
3: 32
4: 277
1132694188_1132694202 19 Left 1132694188 16:1194753-1194775 CCTCACGGAGCAGAGCCCGGCCA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1132694202 16:1194795-1194817 ACCTGGTGGCTGCTTTCAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 217
1132694188_1132694200 16 Left 1132694188 16:1194753-1194775 CCTCACGGAGCAGAGCCCGGCCA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1132694200 16:1194792-1194814 GCCACCTGGTGGCTGCTTTCAGG 0: 1
1: 0
2: 5
3: 19
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132694188 Original CRISPR TGGCCGGGCTCTGCTCCGTG AGG (reversed) Intronic