ID: 1132694190

View in Genome Browser
Species Human (GRCh38)
Location 16:1194761-1194783
Sequence AGCAGAGCCCGGCCAGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 327}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132694171_1132694190 28 Left 1132694171 16:1194710-1194732 CCTGATGAGCCAACGCCGAGGGC 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1132694190 16:1194761-1194783 AGCAGAGCCCGGCCAGGCGCAGG 0: 1
1: 0
2: 3
3: 37
4: 327
1132694176_1132694190 19 Left 1132694176 16:1194719-1194741 CCAACGCCGAGGGCCAGGGGGCC 0: 1
1: 0
2: 2
3: 18
4: 162
Right 1132694190 16:1194761-1194783 AGCAGAGCCCGGCCAGGCGCAGG 0: 1
1: 0
2: 3
3: 37
4: 327
1132694179_1132694190 13 Left 1132694179 16:1194725-1194747 CCGAGGGCCAGGGGGCCGGGCCT 0: 1
1: 0
2: 5
3: 49
4: 416
Right 1132694190 16:1194761-1194783 AGCAGAGCCCGGCCAGGCGCAGG 0: 1
1: 0
2: 3
3: 37
4: 327
1132694185_1132694190 -7 Left 1132694185 16:1194745-1194767 CCTGGGACCCTCACGGAGCAGAG 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1132694190 16:1194761-1194783 AGCAGAGCCCGGCCAGGCGCAGG 0: 1
1: 0
2: 3
3: 37
4: 327
1132694184_1132694190 -2 Left 1132694184 16:1194740-1194762 CCGGGCCTGGGACCCTCACGGAG 0: 1
1: 0
2: 2
3: 45
4: 248
Right 1132694190 16:1194761-1194783 AGCAGAGCCCGGCCAGGCGCAGG 0: 1
1: 0
2: 3
3: 37
4: 327
1132694182_1132694190 6 Left 1132694182 16:1194732-1194754 CCAGGGGGCCGGGCCTGGGACCC 0: 1
1: 0
2: 5
3: 77
4: 704
Right 1132694190 16:1194761-1194783 AGCAGAGCCCGGCCAGGCGCAGG 0: 1
1: 0
2: 3
3: 37
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132694190 Original CRISPR AGCAGAGCCCGGCCAGGCGC AGG Intronic