ID: 1132694192

View in Genome Browser
Species Human (GRCh38)
Location 16:1194768-1194790
Sequence CCCGGCCAGGCGCAGGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 7, 3: 46, 4: 501}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132694187_1132694192 -7 Left 1132694187 16:1194752-1194774 CCCTCACGGAGCAGAGCCCGGCC 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1132694192 16:1194768-1194790 CCCGGCCAGGCGCAGGCCCCAGG 0: 1
1: 0
2: 7
3: 46
4: 501
1132694179_1132694192 20 Left 1132694179 16:1194725-1194747 CCGAGGGCCAGGGGGCCGGGCCT 0: 1
1: 0
2: 5
3: 49
4: 416
Right 1132694192 16:1194768-1194790 CCCGGCCAGGCGCAGGCCCCAGG 0: 1
1: 0
2: 7
3: 46
4: 501
1132694185_1132694192 0 Left 1132694185 16:1194745-1194767 CCTGGGACCCTCACGGAGCAGAG 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1132694192 16:1194768-1194790 CCCGGCCAGGCGCAGGCCCCAGG 0: 1
1: 0
2: 7
3: 46
4: 501
1132694176_1132694192 26 Left 1132694176 16:1194719-1194741 CCAACGCCGAGGGCCAGGGGGCC 0: 1
1: 0
2: 2
3: 18
4: 162
Right 1132694192 16:1194768-1194790 CCCGGCCAGGCGCAGGCCCCAGG 0: 1
1: 0
2: 7
3: 46
4: 501
1132694184_1132694192 5 Left 1132694184 16:1194740-1194762 CCGGGCCTGGGACCCTCACGGAG 0: 1
1: 0
2: 2
3: 45
4: 248
Right 1132694192 16:1194768-1194790 CCCGGCCAGGCGCAGGCCCCAGG 0: 1
1: 0
2: 7
3: 46
4: 501
1132694188_1132694192 -8 Left 1132694188 16:1194753-1194775 CCTCACGGAGCAGAGCCCGGCCA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1132694192 16:1194768-1194790 CCCGGCCAGGCGCAGGCCCCAGG 0: 1
1: 0
2: 7
3: 46
4: 501
1132694182_1132694192 13 Left 1132694182 16:1194732-1194754 CCAGGGGGCCGGGCCTGGGACCC 0: 1
1: 0
2: 5
3: 77
4: 704
Right 1132694192 16:1194768-1194790 CCCGGCCAGGCGCAGGCCCCAGG 0: 1
1: 0
2: 7
3: 46
4: 501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132694192 Original CRISPR CCCGGCCAGGCGCAGGCCCC AGG Intronic