ID: 1132694193

View in Genome Browser
Species Human (GRCh38)
Location 16:1194769-1194791
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 663
Summary {0: 1, 1: 0, 2: 11, 3: 73, 4: 578}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132694193_1132694202 3 Left 1132694193 16:1194769-1194791 CCGGCCAGGCGCAGGCCCCAGGC 0: 1
1: 0
2: 11
3: 73
4: 578
Right 1132694202 16:1194795-1194817 ACCTGGTGGCTGCTTTCAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 217
1132694193_1132694206 8 Left 1132694193 16:1194769-1194791 CCGGCCAGGCGCAGGCCCCAGGC 0: 1
1: 0
2: 11
3: 73
4: 578
Right 1132694206 16:1194800-1194822 GTGGCTGCTTTCAGGAGGGGCGG 0: 1
1: 0
2: 3
3: 35
4: 302
1132694193_1132694205 5 Left 1132694193 16:1194769-1194791 CCGGCCAGGCGCAGGCCCCAGGC 0: 1
1: 0
2: 11
3: 73
4: 578
Right 1132694205 16:1194797-1194819 CTGGTGGCTGCTTTCAGGAGGGG 0: 1
1: 0
2: 3
3: 34
4: 266
1132694193_1132694204 4 Left 1132694193 16:1194769-1194791 CCGGCCAGGCGCAGGCCCCAGGC 0: 1
1: 0
2: 11
3: 73
4: 578
Right 1132694204 16:1194796-1194818 CCTGGTGGCTGCTTTCAGGAGGG 0: 1
1: 0
2: 3
3: 33
4: 322
1132694193_1132694200 0 Left 1132694193 16:1194769-1194791 CCGGCCAGGCGCAGGCCCCAGGC 0: 1
1: 0
2: 11
3: 73
4: 578
Right 1132694200 16:1194792-1194814 GCCACCTGGTGGCTGCTTTCAGG 0: 1
1: 0
2: 5
3: 19
4: 208
1132694193_1132694207 15 Left 1132694193 16:1194769-1194791 CCGGCCAGGCGCAGGCCCCAGGC 0: 1
1: 0
2: 11
3: 73
4: 578
Right 1132694207 16:1194807-1194829 CTTTCAGGAGGGGCGGCCGTCGG 0: 1
1: 0
2: 1
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132694193 Original CRISPR GCCTGGGGCCTGCGCCTGGC CGG (reversed) Intronic