ID: 1132694194

View in Genome Browser
Species Human (GRCh38)
Location 16:1194773-1194795
Sequence TGGCGCCTGGGGCCTGCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 301}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132694194_1132694206 4 Left 1132694194 16:1194773-1194795 CCAGGCGCAGGCCCCAGGCGCCA 0: 1
1: 0
2: 1
3: 21
4: 301
Right 1132694206 16:1194800-1194822 GTGGCTGCTTTCAGGAGGGGCGG 0: 1
1: 0
2: 3
3: 35
4: 302
1132694194_1132694205 1 Left 1132694194 16:1194773-1194795 CCAGGCGCAGGCCCCAGGCGCCA 0: 1
1: 0
2: 1
3: 21
4: 301
Right 1132694205 16:1194797-1194819 CTGGTGGCTGCTTTCAGGAGGGG 0: 1
1: 0
2: 3
3: 34
4: 266
1132694194_1132694204 0 Left 1132694194 16:1194773-1194795 CCAGGCGCAGGCCCCAGGCGCCA 0: 1
1: 0
2: 1
3: 21
4: 301
Right 1132694204 16:1194796-1194818 CCTGGTGGCTGCTTTCAGGAGGG 0: 1
1: 0
2: 3
3: 33
4: 322
1132694194_1132694200 -4 Left 1132694194 16:1194773-1194795 CCAGGCGCAGGCCCCAGGCGCCA 0: 1
1: 0
2: 1
3: 21
4: 301
Right 1132694200 16:1194792-1194814 GCCACCTGGTGGCTGCTTTCAGG 0: 1
1: 0
2: 5
3: 19
4: 208
1132694194_1132694207 11 Left 1132694194 16:1194773-1194795 CCAGGCGCAGGCCCCAGGCGCCA 0: 1
1: 0
2: 1
3: 21
4: 301
Right 1132694207 16:1194807-1194829 CTTTCAGGAGGGGCGGCCGTCGG 0: 1
1: 0
2: 1
3: 7
4: 99
1132694194_1132694202 -1 Left 1132694194 16:1194773-1194795 CCAGGCGCAGGCCCCAGGCGCCA 0: 1
1: 0
2: 1
3: 21
4: 301
Right 1132694202 16:1194795-1194817 ACCTGGTGGCTGCTTTCAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132694194 Original CRISPR TGGCGCCTGGGGCCTGCGCC TGG (reversed) Intronic