ID: 1132694195

View in Genome Browser
Species Human (GRCh38)
Location 16:1194778-1194800
Sequence CGCAGGCCCCAGGCGCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 277}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132694187_1132694195 3 Left 1132694187 16:1194752-1194774 CCCTCACGGAGCAGAGCCCGGCC 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1132694195 16:1194778-1194800 CGCAGGCCCCAGGCGCCACCTGG 0: 1
1: 0
2: 1
3: 32
4: 277
1132694184_1132694195 15 Left 1132694184 16:1194740-1194762 CCGGGCCTGGGACCCTCACGGAG 0: 1
1: 0
2: 2
3: 45
4: 248
Right 1132694195 16:1194778-1194800 CGCAGGCCCCAGGCGCCACCTGG 0: 1
1: 0
2: 1
3: 32
4: 277
1132694179_1132694195 30 Left 1132694179 16:1194725-1194747 CCGAGGGCCAGGGGGCCGGGCCT 0: 1
1: 0
2: 5
3: 49
4: 416
Right 1132694195 16:1194778-1194800 CGCAGGCCCCAGGCGCCACCTGG 0: 1
1: 0
2: 1
3: 32
4: 277
1132694185_1132694195 10 Left 1132694185 16:1194745-1194767 CCTGGGACCCTCACGGAGCAGAG 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1132694195 16:1194778-1194800 CGCAGGCCCCAGGCGCCACCTGG 0: 1
1: 0
2: 1
3: 32
4: 277
1132694182_1132694195 23 Left 1132694182 16:1194732-1194754 CCAGGGGGCCGGGCCTGGGACCC 0: 1
1: 0
2: 5
3: 77
4: 704
Right 1132694195 16:1194778-1194800 CGCAGGCCCCAGGCGCCACCTGG 0: 1
1: 0
2: 1
3: 32
4: 277
1132694188_1132694195 2 Left 1132694188 16:1194753-1194775 CCTCACGGAGCAGAGCCCGGCCA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1132694195 16:1194778-1194800 CGCAGGCCCCAGGCGCCACCTGG 0: 1
1: 0
2: 1
3: 32
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132694195 Original CRISPR CGCAGGCCCCAGGCGCCACC TGG Intronic