ID: 1132694197

View in Genome Browser
Species Human (GRCh38)
Location 16:1194784-1194806
Sequence CAGCCACCAGGTGGCGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 248}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132694197_1132694207 0 Left 1132694197 16:1194784-1194806 CCCCAGGCGCCACCTGGTGGCTG 0: 1
1: 0
2: 1
3: 30
4: 248
Right 1132694207 16:1194807-1194829 CTTTCAGGAGGGGCGGCCGTCGG 0: 1
1: 0
2: 1
3: 7
4: 99
1132694197_1132694211 25 Left 1132694197 16:1194784-1194806 CCCCAGGCGCCACCTGGTGGCTG 0: 1
1: 0
2: 1
3: 30
4: 248
Right 1132694211 16:1194832-1194854 CCGAGTCCCCCACCCCATCCTGG 0: 1
1: 0
2: 1
3: 36
4: 292
1132694197_1132694205 -10 Left 1132694197 16:1194784-1194806 CCCCAGGCGCCACCTGGTGGCTG 0: 1
1: 0
2: 1
3: 30
4: 248
Right 1132694205 16:1194797-1194819 CTGGTGGCTGCTTTCAGGAGGGG 0: 1
1: 0
2: 3
3: 34
4: 266
1132694197_1132694206 -7 Left 1132694197 16:1194784-1194806 CCCCAGGCGCCACCTGGTGGCTG 0: 1
1: 0
2: 1
3: 30
4: 248
Right 1132694206 16:1194800-1194822 GTGGCTGCTTTCAGGAGGGGCGG 0: 1
1: 0
2: 3
3: 35
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132694197 Original CRISPR CAGCCACCAGGTGGCGCCTG GGG (reversed) Intronic