ID: 1132694202

View in Genome Browser
Species Human (GRCh38)
Location 16:1194795-1194817
Sequence ACCTGGTGGCTGCTTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 217}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132694185_1132694202 27 Left 1132694185 16:1194745-1194767 CCTGGGACCCTCACGGAGCAGAG 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1132694202 16:1194795-1194817 ACCTGGTGGCTGCTTTCAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 217
1132694191_1132694202 4 Left 1132694191 16:1194768-1194790 CCCGGCCAGGCGCAGGCCCCAGG 0: 1
1: 0
2: 11
3: 75
4: 632
Right 1132694202 16:1194795-1194817 ACCTGGTGGCTGCTTTCAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 217
1132694193_1132694202 3 Left 1132694193 16:1194769-1194791 CCGGCCAGGCGCAGGCCCCAGGC 0: 1
1: 0
2: 11
3: 73
4: 578
Right 1132694202 16:1194795-1194817 ACCTGGTGGCTGCTTTCAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 217
1132694194_1132694202 -1 Left 1132694194 16:1194773-1194795 CCAGGCGCAGGCCCCAGGCGCCA 0: 1
1: 0
2: 1
3: 21
4: 301
Right 1132694202 16:1194795-1194817 ACCTGGTGGCTGCTTTCAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 217
1132694187_1132694202 20 Left 1132694187 16:1194752-1194774 CCCTCACGGAGCAGAGCCCGGCC 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1132694202 16:1194795-1194817 ACCTGGTGGCTGCTTTCAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 217
1132694188_1132694202 19 Left 1132694188 16:1194753-1194775 CCTCACGGAGCAGAGCCCGGCCA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1132694202 16:1194795-1194817 ACCTGGTGGCTGCTTTCAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132694202 Original CRISPR ACCTGGTGGCTGCTTTCAGG AGG Intronic