ID: 1132694204

View in Genome Browser
Species Human (GRCh38)
Location 16:1194796-1194818
Sequence CCTGGTGGCTGCTTTCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 322}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132694185_1132694204 28 Left 1132694185 16:1194745-1194767 CCTGGGACCCTCACGGAGCAGAG 0: 1
1: 0
2: 0
3: 18
4: 211
Right 1132694204 16:1194796-1194818 CCTGGTGGCTGCTTTCAGGAGGG 0: 1
1: 0
2: 3
3: 33
4: 322
1132694188_1132694204 20 Left 1132694188 16:1194753-1194775 CCTCACGGAGCAGAGCCCGGCCA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1132694204 16:1194796-1194818 CCTGGTGGCTGCTTTCAGGAGGG 0: 1
1: 0
2: 3
3: 33
4: 322
1132694193_1132694204 4 Left 1132694193 16:1194769-1194791 CCGGCCAGGCGCAGGCCCCAGGC 0: 1
1: 0
2: 11
3: 73
4: 578
Right 1132694204 16:1194796-1194818 CCTGGTGGCTGCTTTCAGGAGGG 0: 1
1: 0
2: 3
3: 33
4: 322
1132694191_1132694204 5 Left 1132694191 16:1194768-1194790 CCCGGCCAGGCGCAGGCCCCAGG 0: 1
1: 0
2: 11
3: 75
4: 632
Right 1132694204 16:1194796-1194818 CCTGGTGGCTGCTTTCAGGAGGG 0: 1
1: 0
2: 3
3: 33
4: 322
1132694187_1132694204 21 Left 1132694187 16:1194752-1194774 CCCTCACGGAGCAGAGCCCGGCC 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1132694204 16:1194796-1194818 CCTGGTGGCTGCTTTCAGGAGGG 0: 1
1: 0
2: 3
3: 33
4: 322
1132694194_1132694204 0 Left 1132694194 16:1194773-1194795 CCAGGCGCAGGCCCCAGGCGCCA 0: 1
1: 0
2: 1
3: 21
4: 301
Right 1132694204 16:1194796-1194818 CCTGGTGGCTGCTTTCAGGAGGG 0: 1
1: 0
2: 3
3: 33
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132694204 Original CRISPR CCTGGTGGCTGCTTTCAGGA GGG Intronic