ID: 1132694206

View in Genome Browser
Species Human (GRCh38)
Location 16:1194800-1194822
Sequence GTGGCTGCTTTCAGGAGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 302}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132694187_1132694206 25 Left 1132694187 16:1194752-1194774 CCCTCACGGAGCAGAGCCCGGCC 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1132694206 16:1194800-1194822 GTGGCTGCTTTCAGGAGGGGCGG 0: 1
1: 0
2: 3
3: 35
4: 302
1132694194_1132694206 4 Left 1132694194 16:1194773-1194795 CCAGGCGCAGGCCCCAGGCGCCA 0: 1
1: 0
2: 1
3: 21
4: 301
Right 1132694206 16:1194800-1194822 GTGGCTGCTTTCAGGAGGGGCGG 0: 1
1: 0
2: 3
3: 35
4: 302
1132694193_1132694206 8 Left 1132694193 16:1194769-1194791 CCGGCCAGGCGCAGGCCCCAGGC 0: 1
1: 0
2: 11
3: 73
4: 578
Right 1132694206 16:1194800-1194822 GTGGCTGCTTTCAGGAGGGGCGG 0: 1
1: 0
2: 3
3: 35
4: 302
1132694197_1132694206 -7 Left 1132694197 16:1194784-1194806 CCCCAGGCGCCACCTGGTGGCTG 0: 1
1: 0
2: 1
3: 30
4: 248
Right 1132694206 16:1194800-1194822 GTGGCTGCTTTCAGGAGGGGCGG 0: 1
1: 0
2: 3
3: 35
4: 302
1132694198_1132694206 -8 Left 1132694198 16:1194785-1194807 CCCAGGCGCCACCTGGTGGCTGC 0: 1
1: 0
2: 0
3: 31
4: 214
Right 1132694206 16:1194800-1194822 GTGGCTGCTTTCAGGAGGGGCGG 0: 1
1: 0
2: 3
3: 35
4: 302
1132694199_1132694206 -9 Left 1132694199 16:1194786-1194808 CCAGGCGCCACCTGGTGGCTGCT 0: 1
1: 0
2: 2
3: 30
4: 248
Right 1132694206 16:1194800-1194822 GTGGCTGCTTTCAGGAGGGGCGG 0: 1
1: 0
2: 3
3: 35
4: 302
1132694188_1132694206 24 Left 1132694188 16:1194753-1194775 CCTCACGGAGCAGAGCCCGGCCA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1132694206 16:1194800-1194822 GTGGCTGCTTTCAGGAGGGGCGG 0: 1
1: 0
2: 3
3: 35
4: 302
1132694191_1132694206 9 Left 1132694191 16:1194768-1194790 CCCGGCCAGGCGCAGGCCCCAGG 0: 1
1: 0
2: 11
3: 75
4: 632
Right 1132694206 16:1194800-1194822 GTGGCTGCTTTCAGGAGGGGCGG 0: 1
1: 0
2: 3
3: 35
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132694206 Original CRISPR GTGGCTGCTTTCAGGAGGGG CGG Intronic