ID: 1132694207

View in Genome Browser
Species Human (GRCh38)
Location 16:1194807-1194829
Sequence CTTTCAGGAGGGGCGGCCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 99}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132694198_1132694207 -1 Left 1132694198 16:1194785-1194807 CCCAGGCGCCACCTGGTGGCTGC 0: 1
1: 0
2: 0
3: 31
4: 214
Right 1132694207 16:1194807-1194829 CTTTCAGGAGGGGCGGCCGTCGG 0: 1
1: 0
2: 1
3: 7
4: 99
1132694201_1132694207 -9 Left 1132694201 16:1194793-1194815 CCACCTGGTGGCTGCTTTCAGGA 0: 1
1: 0
2: 2
3: 52
4: 473
Right 1132694207 16:1194807-1194829 CTTTCAGGAGGGGCGGCCGTCGG 0: 1
1: 0
2: 1
3: 7
4: 99
1132694193_1132694207 15 Left 1132694193 16:1194769-1194791 CCGGCCAGGCGCAGGCCCCAGGC 0: 1
1: 0
2: 11
3: 73
4: 578
Right 1132694207 16:1194807-1194829 CTTTCAGGAGGGGCGGCCGTCGG 0: 1
1: 0
2: 1
3: 7
4: 99
1132694194_1132694207 11 Left 1132694194 16:1194773-1194795 CCAGGCGCAGGCCCCAGGCGCCA 0: 1
1: 0
2: 1
3: 21
4: 301
Right 1132694207 16:1194807-1194829 CTTTCAGGAGGGGCGGCCGTCGG 0: 1
1: 0
2: 1
3: 7
4: 99
1132694197_1132694207 0 Left 1132694197 16:1194784-1194806 CCCCAGGCGCCACCTGGTGGCTG 0: 1
1: 0
2: 1
3: 30
4: 248
Right 1132694207 16:1194807-1194829 CTTTCAGGAGGGGCGGCCGTCGG 0: 1
1: 0
2: 1
3: 7
4: 99
1132694191_1132694207 16 Left 1132694191 16:1194768-1194790 CCCGGCCAGGCGCAGGCCCCAGG 0: 1
1: 0
2: 11
3: 75
4: 632
Right 1132694207 16:1194807-1194829 CTTTCAGGAGGGGCGGCCGTCGG 0: 1
1: 0
2: 1
3: 7
4: 99
1132694199_1132694207 -2 Left 1132694199 16:1194786-1194808 CCAGGCGCCACCTGGTGGCTGCT 0: 1
1: 0
2: 2
3: 30
4: 248
Right 1132694207 16:1194807-1194829 CTTTCAGGAGGGGCGGCCGTCGG 0: 1
1: 0
2: 1
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132694207 Original CRISPR CTTTCAGGAGGGGCGGCCGT CGG Intronic