ID: 1132694713

View in Genome Browser
Species Human (GRCh38)
Location 16:1196752-1196774
Sequence AGTCATATGCCTGCTTGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132694713 Original CRISPR AGTCATATGCCTGCTTGTTT GGG Intronic
909098673 1:71322675-71322697 GGTCTTTTGCCTCCTTGTTTAGG - Intergenic
913218976 1:116644305-116644327 AGTCATTTGGCCGCTTGTTAAGG + Intronic
913489640 1:119366932-119366954 AGCAATATGCCTGCTTATTTTGG - Intergenic
915123625 1:153648290-153648312 AGTCATAGGCCTCATTGTGTGGG + Intergenic
916504668 1:165417303-165417325 AGTGATATGCCTGTTTCTCTGGG - Intronic
920353611 1:205354042-205354064 ACTCAAATGGCTGCTGGTTTGGG + Intronic
920508240 1:206532155-206532177 AGTGATTTGTGTGCTTGTTTTGG + Intronic
921360763 1:214329383-214329405 AGACATTTGCCTGATTGTGTGGG + Intronic
923140692 1:231160067-231160089 AGCCATATGGCTGCTGGTTTGGG + Intergenic
1063209937 10:3870857-3870879 AGTCATTTGCAAGCTTGCTTTGG - Intergenic
1064995065 10:21289392-21289414 AGTCCTATTGCTGCTGGTTTGGG - Intergenic
1065235111 10:23642010-23642032 AGTCATATGCCTCCTTGACAAGG - Intergenic
1065863953 10:29897362-29897384 AGTCAAATGCCTTTTTGTTCAGG + Intergenic
1068767699 10:60781977-60781999 ACTCCAATGCCTGATTGTTTTGG + Intronic
1072148217 10:92662500-92662522 AGTCATTTCCCTTGTTGTTTTGG + Intergenic
1076605934 10:131689865-131689887 AGTCACATGCGTGCCTGTCTTGG + Intergenic
1077705474 11:4481291-4481313 ATTCATATGCATCTTTGTTTTGG - Intergenic
1078434470 11:11313072-11313094 AGCCAAAAGCCTGCTTCTTTAGG - Intronic
1081033032 11:38110954-38110976 AGACTTCTGCCTGCTTATTTAGG - Intergenic
1082564799 11:54663548-54663570 ATTCACATGACTGATTGTTTAGG + Intergenic
1091169397 11:133506963-133506985 AGTCAGATGCCTGTTGGGTTTGG - Intronic
1097738973 12:63216207-63216229 CGTCATATCCCTACTTGTGTTGG + Intergenic
1098618089 12:72554907-72554929 GGTCATGTGCCTGCATGTTGAGG + Intronic
1101701706 12:107179889-107179911 GGTCATAAGCCTTTTTGTTTAGG + Intergenic
1105509993 13:21043098-21043120 AGTGATCTGCCTGCTTCGTTCGG - Intronic
1106847619 13:33753094-33753116 AGACATATGCCGGTTTATTTGGG + Intergenic
1108194587 13:47980058-47980080 AGTCTTATGCCTCCTCGATTAGG - Intronic
1109132677 13:58608819-58608841 AGGCATATGCCAGCATCTTTGGG + Intergenic
1112046234 13:95601256-95601278 GGACATCAGCCTGCTTGTTTTGG - Intronic
1112640849 13:101273344-101273366 AGCTATATACCTGCTTGGTTTGG + Intronic
1114501474 14:23172305-23172327 AGTCATTTGTCTGCTGGTCTAGG + Intronic
1114960004 14:27874164-27874186 AGTCATTTGTCTCCTTGGTTAGG + Intergenic
1117612914 14:57502852-57502874 AGCCAGAGGCCTGCTTGTGTAGG - Intergenic
1121699783 14:95943903-95943925 AGCCATTTGCCTGCCTCTTTCGG + Intergenic
1123840475 15:24242746-24242768 AGTCATATTCCTCCTTTTTCTGG + Intergenic
1123853427 15:24383261-24383283 AGTCATATTCCTCCTTTTTCTGG + Intergenic
1124274423 15:28313858-28313880 AGTCTCATCCCTGCTTGCTTAGG - Intronic
1125470637 15:39999747-39999769 AGTCATGTTTCTGCTTCTTTTGG + Intronic
1129269702 15:74413064-74413086 AATCATCTGACTGCTTTTTTGGG - Intronic
1130154330 15:81336662-81336684 AATGATATGCATGTTTGTTTTGG + Intronic
1132694713 16:1196752-1196774 AGTCATATGCCTGCTTGTTTGGG + Intronic
1134517473 16:14898807-14898829 AGTCACATGCCAGCTTGTCTAGG + Intronic
1134705141 16:16297458-16297480 AGTCACATGCCAGCTTGTCTAGG + Intergenic
1134962400 16:18414656-18414678 AGTCACATGCCAGCTTGTCTAGG - Intergenic
1134966697 16:18497255-18497277 AGTCACATGCCAGCTTGTCTAGG - Intronic
1135094745 16:19555701-19555723 AGTCACATGACCGCTTGTTCTGG - Exonic
1135926020 16:26694775-26694797 AGACATATGCCTGGATGTTCAGG - Intergenic
1140467569 16:75194744-75194766 AGTGATCTGCCTGCCTGTCTCGG - Intergenic
1147561228 17:41510555-41510577 TGTCATTTGCCTGCTTGCTGTGG - Intergenic
1149194107 17:54099212-54099234 AGTGATATGCTTGTATGTTTTGG + Intergenic
1149332388 17:55598141-55598163 AGTCTTTTGCCTACTTGTTTAGG + Intergenic
1150729364 17:67678505-67678527 AGTGAAAAGGCTGCTTGTTTTGG - Intronic
1151361463 17:73591764-73591786 AGTCATGTGCCTGCATGAGTAGG - Intronic
1151538335 17:74750927-74750949 ACTCAGATTCCTGCATGTTTTGG + Intronic
1153932482 18:9890437-9890459 ATTCCTAAGCCTGCTTATTTTGG - Intergenic
1155245161 18:23901263-23901285 AGCCATTTGCCTGCTTGGCTTGG - Exonic
1155770256 18:29688905-29688927 AGTAATATGCTTTCTTGTGTGGG - Intergenic
1157648977 18:49307842-49307864 AGTCATTTTCCTCCTTCTTTTGG - Intronic
1158099636 18:53815964-53815986 AGTCATATTTCTTCTTGTCTGGG + Intergenic
1159730863 18:72025799-72025821 ATAAATATGTCTGCTTGTTTTGG + Intergenic
1160906829 19:1455601-1455623 AGTCTTATGCCTCCTGGGTTGGG + Intronic
925700664 2:6634191-6634213 AGTCTTATGCCTTCTTTTTATGG + Intergenic
928025309 2:27734835-27734857 AGCCATATGCTTAATTGTTTGGG + Intergenic
929915609 2:46133068-46133090 AGACATACGCCTACTAGTTTTGG + Intronic
932625004 2:73290599-73290621 AGGTATATGCCTGCTTTATTTGG + Intergenic
935069814 2:99684203-99684225 AGCCATCTGCCTCCTTGTTCAGG + Intronic
938941664 2:136175128-136175150 AGTCTGATGCCTGATTGCTTGGG + Intergenic
939782768 2:146469646-146469668 AGAAATATGCCAGATTGTTTGGG - Intergenic
941939195 2:171015641-171015663 AGTGATATGTGTACTTGTTTTGG - Intronic
941968128 2:171320937-171320959 AGTCATACACCTGCTAGTCTAGG + Exonic
947681598 2:232038567-232038589 ATTCATATGTTTGCTTATTTTGG - Intronic
1169003182 20:2183193-2183215 AGGCAGATGGCTGCTAGTTTTGG - Intergenic
1169756105 20:9045092-9045114 GGTCATAAGCCTGCTAGGTTTGG - Intergenic
1176837924 21:13811116-13811138 GGTCTTATTCTTGCTTGTTTTGG + Intergenic
1178006616 21:28227627-28227649 AGTAATAAGCCTGCTTTGTTAGG + Intergenic
1178176028 21:30100017-30100039 ACTCAGATGTCTGTTTGTTTTGG - Intergenic
1180820270 22:18822362-18822384 AGTCATTTGGCCGCTTGTTAAGG + Intergenic
1181206495 22:21256834-21256856 AGTCATTTGGCCGCTTGTTAAGG + Intergenic
1203220425 22_KI270731v1_random:38589-38611 AGTCATTTGGCCGCTTGTTAAGG - Intergenic
1203270400 22_KI270734v1_random:48237-48259 AGTCATTTGGCCGCTTGTTAAGG + Intergenic
950645593 3:14374741-14374763 AGTGACATGCCTGCATGTCTGGG + Intergenic
950998055 3:17526033-17526055 AGTCATATTTCTGCTTGTAATGG + Intronic
953283820 3:41584940-41584962 AGTCTTTTGCCTCCTTGGTTAGG - Intronic
954108430 3:48421319-48421341 AGTCATATTCCTGCCACTTTGGG - Exonic
955364526 3:58299781-58299803 AGTCATTCCCCTGCTTGTCTGGG - Intergenic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
961551983 3:127674544-127674566 GGTACTATGCCTGCTTGTGTGGG + Exonic
964201842 3:154126248-154126270 GGGCAGATGCATGCTTGTTTTGG + Intronic
964784257 3:160376880-160376902 AGTCATATGAAGGCTTGTCTGGG - Intronic
968209766 3:196839174-196839196 ATGCATAAGCCTACTTGTTTAGG - Intergenic
971071898 4:23104330-23104352 AGACATTTGCCTCATTGTTTTGG - Intergenic
972496809 4:39641824-39641846 AGTCATCTGAATGCTTGATTAGG - Intergenic
975245167 4:72112043-72112065 AGGCCTATGATTGCTTGTTTGGG + Intronic
976139273 4:81973324-81973346 ATTGCTCTGCCTGCTTGTTTTGG - Intronic
977689461 4:99889545-99889567 ACACATATGCCTGCATATTTTGG - Intronic
977797732 4:101187875-101187897 AGTAATATGCATGTTTGCTTTGG - Intronic
978734312 4:112067651-112067673 ATTCTTATGCCTACTTGCTTGGG + Intergenic
979109120 4:116728365-116728387 AGTTAGATTCCTGCTTGTGTTGG + Intergenic
979387685 4:120088636-120088658 AGTCATCTGACTGCTTGATAGGG + Intergenic
982421648 4:155206144-155206166 ACTCAGATGCCTGCATGGTTAGG - Intergenic
982913639 4:161177483-161177505 AATCAAATTCCTGTTTGTTTTGG - Intergenic
982927998 4:161364111-161364133 ACCCATATGGCTGCTTGTATGGG - Intergenic
983618171 4:169730837-169730859 AGTCATATGCATTTTAGTTTGGG + Intronic
983821962 4:172205878-172205900 AGTTCTATGCCTTGTTGTTTTGG + Intronic
987794266 5:22607247-22607269 AGACATATTCCTCATTGTTTTGG - Intronic
989030000 5:37109176-37109198 AGCCACATGACTGCTTGTTTGGG - Intronic
990240727 5:53813681-53813703 AGTCATGTGCCTGTTTTTATAGG - Intergenic
992236612 5:74716107-74716129 AGTAACATGCCTGCTTGTAAGGG + Intronic
993265282 5:85719023-85719045 AAACATCTGCCTGCTTATTTAGG - Intergenic
995709208 5:115017764-115017786 CTTTCTATGCCTGCTTGTTTAGG - Intergenic
995783063 5:115798194-115798216 GGTCATAAGCCTGCAGGTTTGGG + Intergenic
996032313 5:118719655-118719677 GGTCTTTTGCCTCCTTGTTTAGG - Intergenic
1001175850 5:169468228-169468250 ATTCATATGACTCCCTGTTTTGG + Intergenic
1001994736 5:176147381-176147403 AGGCAGATGCCTGCTGTTTTGGG - Intergenic
1007142927 6:39594346-39594368 AGAAATGTGTCTGCTTGTTTTGG - Intronic
1009023711 6:57972777-57972799 AGTGAGATGCCTGCTTGGCTTGG - Intergenic
1009055291 6:58327758-58327780 AGACATATTCCTGCTGCTTTAGG + Intergenic
1009199286 6:60724329-60724351 AGTGAGATGCCTGCTTGGCTTGG - Intergenic
1009235870 6:61122820-61122842 AGACATATTCCTGCTGCTTTAGG - Intergenic
1015877913 6:137842741-137842763 AGTCATATCCATGCCTGTTCTGG + Intergenic
1021070001 7:16225560-16225582 AAGCATATACCTGCTTTTTTTGG - Intronic
1022724724 7:32970538-32970560 AGTCTTTTGCCTCCTTGGTTAGG + Intronic
1025048877 7:55717290-55717312 AGTCTTTTGCCTCCTTGGTTAGG - Intergenic
1031235343 7:119168675-119168697 AGTCAGAGGTCTGCCTGTTTGGG - Intergenic
1033647854 7:143318857-143318879 ATTCATGTGCGTGCTTGTTCAGG + Intronic
1036753894 8:11460037-11460059 TTTCATTTGTCTGCTTGTTTTGG + Intronic
1037085232 8:14840751-14840773 AATCAAATGCCTTCTTTTTTAGG - Intronic
1037763501 8:21757335-21757357 ACTCATATGCCTGCCTGCTGGGG - Intronic
1039822158 8:41144061-41144083 AGTCTTATGCCTTCTTGTAGTGG - Intergenic
1041127095 8:54653502-54653524 AGTCATATTCCTGATATTTTCGG + Intergenic
1041685571 8:60641774-60641796 AGTCAAAGGCCTTCTTGTGTGGG - Intergenic
1048759565 8:137778704-137778726 AGTCATATTTCTGCTTTCTTGGG - Intergenic
1050439570 9:5647510-5647532 AGTCTTTTGCCTGCTTGGTTAGG + Intronic
1051519504 9:17969848-17969870 AGGCATATGCAAACTTGTTTTGG + Intergenic
1058467322 9:105242748-105242770 AGACAGATGGCTTCTTGTTTAGG + Intergenic
1058708742 9:107659982-107660004 GGTCATTTGCTTGTTTGTTTTGG + Intergenic
1060368262 9:123042389-123042411 TGTCATTTGCTTGATTGTTTTGG - Intronic
1186545425 X:10444284-10444306 AGCCATGTGCCTTCTTGTCTAGG - Intergenic
1187047491 X:15661697-15661719 TTTCATATGCCTTCTTTTTTGGG - Intronic
1190929511 X:54935554-54935576 ATTCATATGCATTCTTGTCTGGG + Intronic
1193784994 X:85750135-85750157 GGTCTTTTGCCTCCTTGTTTAGG + Intergenic
1194213955 X:91105585-91105607 AGTCTTTTGCCTCCTTGATTAGG + Intergenic
1196171895 X:112597758-112597780 AGTCTTTTGCCTCCTTGGTTAGG - Intergenic
1198144682 X:133843131-133843153 AGTCATCTGAAGGCTTGTTTGGG - Intronic
1201853899 Y:18519637-18519659 AAACATATGCATGCTTCTTTTGG - Intergenic
1201879422 Y:18800747-18800769 AAACATATGCATGCTTCTTTTGG + Intronic