ID: 1132696093

View in Genome Browser
Species Human (GRCh38)
Location 16:1202601-1202623
Sequence CATAAGAAGGGGAAAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 622
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 560}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132696083_1132696093 20 Left 1132696083 16:1202558-1202580 CCAGCTTTGACTTGTGAAACAGA 0: 1
1: 0
2: 2
3: 23
4: 159
Right 1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG 0: 1
1: 0
2: 3
3: 58
4: 560
1132696085_1132696093 -3 Left 1132696085 16:1202581-1202603 CCAGCTATGCCTCTGGAGCCCAT 0: 1
1: 0
2: 1
3: 17
4: 168
Right 1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG 0: 1
1: 0
2: 3
3: 58
4: 560
1132696082_1132696093 21 Left 1132696082 16:1202557-1202579 CCCAGCTTTGACTTGTGAAACAG 0: 1
1: 0
2: 2
3: 10
4: 151
Right 1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG 0: 1
1: 0
2: 3
3: 58
4: 560

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132696093 Original CRISPR CATAAGAAGGGGAAAGAGGC AGG Intronic
900626459 1:3610901-3610923 CAAAAGAAGGGGAGAGTGGGAGG + Intronic
900894591 1:5474380-5474402 CAGTAGAAGGCGAGAGAGGCAGG + Intergenic
901567847 1:10133612-10133634 AATAAAGAGGAGAAAGAGGCCGG + Intronic
901733430 1:11296814-11296836 CATAAGAAAGGAAAGGGGGCTGG - Intergenic
902046442 1:13528267-13528289 CAAAGGAAGAGAAAAGAGGCTGG - Intergenic
902630912 1:17704038-17704060 TATAAAAAGAAGAAAGAGGCCGG - Intergenic
903288519 1:22292192-22292214 CACATGAAGGGGAAAGACGCTGG + Intergenic
903613411 1:24633717-24633739 TATAAGAAGGGGAAATTGGCTGG - Intronic
903817332 1:26073926-26073948 AATAAGAAAAGAAAAGAGGCTGG - Intergenic
903834855 1:26197204-26197226 CACAAGAAAGGGAGACAGGCGGG - Intronic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904196343 1:28788593-28788615 ACTAAGAAGAGGAGAGAGGCAGG - Intergenic
904510706 1:31004438-31004460 CATAAGATGAGGAAAGAGTGAGG + Intronic
904619259 1:31765626-31765648 CAGAAGGAGGGAAAAGAGGGCGG - Intergenic
904862548 1:33549701-33549723 GATAAGAAAGGGAAGGAGGCTGG + Intronic
904868714 1:33602788-33602810 CATAAGAAAGAGAAAGAGGGAGG - Intronic
905937198 1:41834054-41834076 AATAAGAAAGGTCAAGAGGCTGG + Intronic
907124322 1:52035763-52035785 CATAAGGAGGAGGAAAAGGCAGG - Intronic
907246741 1:53113816-53113838 CAGCAGAAGGGGTGAGAGGCAGG - Intronic
907278576 1:53330176-53330198 GAAAAGAAAGGAAAAGAGGCCGG + Intergenic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907976002 1:59432050-59432072 CACCAGGAGGGGAGAGAGGCTGG + Intronic
908606352 1:65801123-65801145 AGTAAGAAGGGGTAAGAGACAGG - Intronic
909999374 1:82324139-82324161 TATAAAAACGGGGAAGAGGCCGG + Intergenic
910318189 1:85913585-85913607 CATAAGAAGCCCAAAGTGGCCGG - Intronic
911018585 1:93363168-93363190 GTTAAGATGGGGAAAGAGGAGGG - Exonic
911129357 1:94373425-94373447 CATCAGAAGGGGAAGGAGAGGGG - Intergenic
911189797 1:94936405-94936427 CATGAGAAAGAGAAAGTGGCAGG - Intergenic
911504696 1:98734061-98734083 CAGAAGAATGGACAAGAGGCTGG - Intronic
911768018 1:101702048-101702070 AATAAGAAGAGGCTAGAGGCCGG - Intergenic
912421593 1:109545754-109545776 CATCAAAAGGGGAAATGGGCTGG + Exonic
912481476 1:109984994-109985016 CGCCAGAGGGGGAAAGAGGCGGG + Exonic
913366199 1:118041957-118041979 GAGAAGAAGGGTAAAGAAGCTGG - Exonic
914405356 1:147365317-147365339 CATAAAAAGTTGAAAGAGGTTGG - Intergenic
914929890 1:151921619-151921641 CAGAAGAAAGATAAAGAGGCAGG + Intergenic
915508489 1:156372391-156372413 ACAAAGAAGGGGAAAGAGCCAGG + Intronic
915543940 1:156585298-156585320 CATAAGAAGCGGAGGCAGGCGGG - Intronic
915555314 1:156657857-156657879 CACGAGAAAGGGAAGGAGGCCGG - Intronic
916242761 1:162656593-162656615 CATAAGGAAGGAAAAGAGGAAGG - Intronic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
917015282 1:170523844-170523866 CAAAAGAAGAGGAAAAAGGAAGG + Intergenic
917479753 1:175402009-175402031 CATAAAAAAGGGAATCAGGCCGG + Intronic
917726928 1:177837071-177837093 CTGAAGATGGGGAAAGAGGGAGG + Intergenic
917980417 1:180265756-180265778 CATAGGAAGGGGATGGAGGTAGG + Intronic
917989793 1:180362422-180362444 CAAAAGAAGGTGAAACAGGATGG + Intronic
918491859 1:185089731-185089753 TATAAGATGGAGATAGAGGCCGG + Intronic
920008429 1:202850446-202850468 CAGAAGGAAGGGAAAGAGGTTGG - Intergenic
920443947 1:206001697-206001719 GACAAGAAGGGGAAAGAGCTGGG - Intronic
921986535 1:221318580-221318602 CATAAAAAGGCCAAAGAGGCTGG - Intergenic
922443061 1:225672604-225672626 TATTAGAACTGGAAAGAGGCTGG - Intergenic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922990060 1:229900036-229900058 CATAACAATGAGAAAAAGGCAGG + Intergenic
923818041 1:237402629-237402651 CAAAAGATTGGGAAACAGGCTGG + Intronic
924736472 1:246761369-246761391 AATAAGAAGAAAAAAGAGGCCGG - Intronic
1063228446 10:4039682-4039704 AATAAGAAGAAGAAAGAGGAGGG - Intergenic
1063468927 10:6268723-6268745 CATAAAGAGGTTAAAGAGGCTGG + Intergenic
1063574160 10:7246422-7246444 CATAAGAATGTGAGAGAGGCCGG + Intronic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1064575750 10:16744867-16744889 GAAAAGAAGGGGCAAGAGGGAGG - Intronic
1065962745 10:30747281-30747303 CCTAAGCTGGGGAAAAAGGCAGG + Intergenic
1066005228 10:31140836-31140858 CATATGAAGGGCAAGGAGTCAGG - Intergenic
1067129603 10:43550913-43550935 CATAAGATTGGGAACAAGGCAGG - Intergenic
1067760515 10:49041914-49041936 TATTAGAAGGGGTAAGAGACTGG + Intronic
1068510874 10:57964165-57964187 GTTAAGAAGGGGAAAAAGCCAGG - Intergenic
1069444291 10:68458550-68458572 AAAAAGAAGAAGAAAGAGGCTGG + Intronic
1070037182 10:72737814-72737836 CAGAAAAAGGGGAAATAGGCTGG - Intronic
1071423013 10:85520244-85520266 CATCAGAAGAGGAAAGTGTCAGG - Intergenic
1071725690 10:88196208-88196230 AAAAAGAAGGGGAAAGTGGGAGG + Intergenic
1074104342 10:110377153-110377175 GATAAGCTGGGGAAAGAGGCGGG - Intergenic
1074180917 10:111062078-111062100 CACAAAAAGGAGAAAGAGACAGG + Intergenic
1074253061 10:111772869-111772891 CATAAGAAGAGGACAGTGGTTGG + Intergenic
1074716247 10:116222104-116222126 CGGTAGAAGGGGAAAGAGCCAGG + Intronic
1075104962 10:119533059-119533081 CATAAAAAAAGAAAAGAGGCCGG + Intronic
1075425368 10:122337939-122337961 CCCCAGAAGGGGAAAGAGGAAGG - Intronic
1075583431 10:123639702-123639724 CATCAGAAGGTGGAAGAGGGTGG - Intergenic
1075913790 10:126148842-126148864 GGGAAGAAGGGGAAAGAGGTCGG - Intronic
1076195909 10:128518053-128518075 CCTCAGAAGGGGAAAGGAGCAGG + Intergenic
1076275545 10:129195705-129195727 CATAAGAAGGGGTCAGATTCTGG - Intergenic
1077905267 11:6528070-6528092 ATTAAGAGGGGGAAAGAGTCAGG + Intronic
1078105118 11:8353604-8353626 CTTAAGGTGGGGAAAGAGGAGGG - Intergenic
1078184838 11:9042784-9042806 ACTGAGAAGGGGAAAGAGGTGGG - Intronic
1078251327 11:9619012-9619034 TGTAAGCAGAGGAAAGAGGCAGG - Intergenic
1078279118 11:9881824-9881846 AATAAGAAGAAGAAATAGGCTGG + Intronic
1078797925 11:14611896-14611918 GAAAGGAAGGGGATAGAGGCTGG - Intronic
1079086797 11:17451894-17451916 CAGAAGAAGGGACAAGAGGAGGG - Intronic
1079190449 11:18272693-18272715 GCCAAGATGGGGAAAGAGGCAGG + Intergenic
1079464891 11:20720501-20720523 GATAAGAACAGAAAAGAGGCTGG - Intronic
1079845224 11:25457955-25457977 TATAAAAATGGGAGAGAGGCAGG - Intergenic
1081206119 11:40277453-40277475 AAGAAGAGGGGGAAAGAGGAAGG + Intronic
1082020694 11:47530656-47530678 TTTAAGAAGAGGAAAAAGGCTGG + Intronic
1082082049 11:48019644-48019666 AATTAGAAGGGGAAAGCTGCCGG - Intronic
1083789486 11:64975250-64975272 CATAAGAAGCCCAAAGTGGCCGG - Intergenic
1084200075 11:67550890-67550912 CAACAGAAGGGGAAGCAGGCAGG - Intergenic
1084506157 11:69569797-69569819 AAGAAGAAGGGGACAGAGACAGG - Intergenic
1084934335 11:72579044-72579066 CCTCAGAAGGGCAAAGAGGCTGG - Intronic
1086407727 11:86513170-86513192 GATAAGAAGGAGAGAGAGGAGGG + Intronic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087296657 11:96385130-96385152 CAAGAGAAGTGGAAAGATGCAGG + Intronic
1087343011 11:96932974-96932996 AATATGAAGGGGCAAGAGGAAGG - Intergenic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089225991 11:116922489-116922511 AAAAAGAAGGGGGAAGGGGCGGG + Intronic
1089250122 11:117153188-117153210 CATCAGAATGGTGAAGAGGCAGG - Intronic
1090365498 11:126201914-126201936 CACAAGAATGGAGAAGAGGCTGG - Intergenic
1090395646 11:126416394-126416416 CAGAAAAAGGCGACAGAGGCTGG - Intronic
1090673306 11:128966396-128966418 CATTAGAAAGGGAAAGATGCCGG + Exonic
1090905490 11:131070938-131070960 CTTAATAAGGGGAAGGAGGTAGG - Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091977710 12:4838822-4838844 CATAAAAAGGGGAGAGACACTGG - Intronic
1092013816 12:5139875-5139897 TATAAGAATGGTAAAGATGCAGG + Intergenic
1092034005 12:5315006-5315028 TTTAAAAAGGGGAAAGAGGAAGG - Intergenic
1092162151 12:6321540-6321562 CTAAAGAAGAGGGAAGAGGCCGG + Intronic
1092234779 12:6799883-6799905 CAGAAGCAAGAGAAAGAGGCAGG - Intronic
1092910759 12:13142945-13142967 CAAAGGAAGAGGAGAGAGGCTGG - Intergenic
1093206822 12:16261223-16261245 AATGAGAAGGGGTAAGAGGAAGG - Intronic
1093246975 12:16750831-16750853 CATAAGAAGGAGAAAAAGCAAGG - Intergenic
1093257682 12:16890818-16890840 GAAAAGTAGGGGGAAGAGGCGGG + Intergenic
1093269138 12:17037167-17037189 AAGAGGAAGGGGAAAGAAGCAGG - Intergenic
1093743609 12:22715139-22715161 AGTAAGAAGGAGAAAGAGGGAGG - Intergenic
1094527926 12:31245223-31245245 CATAAGAATGGCAAATTGGCCGG + Intergenic
1095958954 12:47821649-47821671 CAACAGAAGGAGAAAGGGGCTGG - Intronic
1096212982 12:49780574-49780596 CAAAGGAGGGGGAAAGAAGCAGG - Intergenic
1096864686 12:54555449-54555471 CAGAGGAAGGCGAAAGAGGTTGG + Intronic
1097012765 12:55965221-55965243 CATTAGAAAGGGAATGAGGCCGG - Intronic
1097604484 12:61735638-61735660 CAAAAGAAGGCAAAAGAGGAGGG - Intronic
1097623480 12:61971050-61971072 AAGAAGAAGTGGAAAGAAGCTGG + Intronic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097759783 12:63449784-63449806 TTTAAAAAGTGGAAAGAGGCTGG + Intergenic
1099189506 12:79547909-79547931 GAAAAGGAGGGGAAAGAGGAAGG - Intergenic
1099879883 12:88455220-88455242 TATAAAAAGAAGAAAGAGGCCGG - Intergenic
1100578548 12:95916412-95916434 AATAAGAAGGGAAAAAAGGAAGG - Intronic
1101609024 12:106273697-106273719 CGTAAGAAGTGGAAATAGGCCGG + Intronic
1102325720 12:111981676-111981698 CAAAAGCCTGGGAAAGAGGCTGG + Intronic
1102500308 12:113347562-113347584 TATAAAAAGGAGAAAGGGGCTGG + Intronic
1102600342 12:114025024-114025046 CTTATGAAGGGGAAAGGGGTGGG - Intergenic
1102702817 12:114854448-114854470 CCTAAGGAGGGGAGAGGGGCTGG + Intergenic
1103116363 12:118336773-118336795 TACAAAAAGGGCAAAGAGGCTGG + Intronic
1103138097 12:118525292-118525314 AAAAAGAAGGGGAAAGAGAAAGG - Intergenic
1103583125 12:121931043-121931065 TATAAGAAAGGCAAATAGGCTGG - Intronic
1103646460 12:122397226-122397248 CATCAGAAGGGCAAAGAGCATGG - Intronic
1103751371 12:123165670-123165692 TATGAAAAAGGGAAAGAGGCAGG + Intronic
1103954964 12:124571006-124571028 CAACAGAGGGGGAAGGAGGCAGG + Intergenic
1104176351 12:126336437-126336459 CATGAGGAGGGGGAAGAGCCTGG + Intergenic
1104658008 12:130588202-130588224 CATGAGAAGGGGCTGGAGGCTGG - Intronic
1105309010 13:19189871-19189893 AATGAGAAGGGGAAAAAGGAAGG - Intergenic
1105528594 13:21198276-21198298 AATGAGAAGGGGAAAAAGGAAGG + Intergenic
1105679098 13:22706987-22707009 CATAAGCAGGGCAAAGAGTTAGG + Intergenic
1105764837 13:23548927-23548949 CATAGAAAGGGGAAAAGGGCTGG - Intergenic
1106099334 13:26681117-26681139 CATAGGAAGGGGTCACAGGCTGG - Exonic
1106812005 13:33368030-33368052 AATAAGAAAGAGAAAGAGGAAGG - Intergenic
1107196540 13:37659311-37659333 CATCACAGGGGGAAAGAGGAAGG - Intronic
1107370336 13:39738468-39738490 CAAAAGAAGGTGAAAAAGGAGGG + Intronic
1107806686 13:44159912-44159934 CAAAAGGTGGGGAAAGAGGAAGG + Intronic
1107896301 13:44967233-44967255 CTTCAGAAAGTGAAAGAGGCCGG + Intronic
1107952154 13:45473163-45473185 CATTACAAGAGGAAACAGGCCGG - Intronic
1108684950 13:52811116-52811138 AATCAAAAGGGGCAAGAGGCAGG - Intergenic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1110045118 13:70818439-70818461 CATACAAAGAGCAAAGAGGCAGG + Intergenic
1110609154 13:77469840-77469862 CATAAAAAGGGGATCAAGGCTGG - Intergenic
1111945197 13:94657904-94657926 CAAAAGAAGGGAACAGATGCTGG - Intergenic
1112211089 13:97377920-97377942 CATAAGCAGCGGAAAGATGGAGG - Intronic
1112765132 13:102733671-102733693 CATAAGAAGTGGGAAAAGGCCGG - Exonic
1113930258 13:113964618-113964640 GATGAGAAGGGGGAAGAGGAGGG - Intergenic
1114483579 14:23049575-23049597 GAGGAGAAGGGGACAGAGGCAGG + Intronic
1115366093 14:32558800-32558822 CACAAGAAGGGGAAAATGGAGGG + Intronic
1115475574 14:33810148-33810170 CATCTGCAGGTGAAAGAGGCAGG + Intergenic
1116368143 14:44095069-44095091 CAAAAGAAGAGAAAAGAGGAAGG + Intergenic
1116433063 14:44868504-44868526 CATAGGAAGGAGAAAGAGCCAGG + Intergenic
1116853520 14:49931616-49931638 TATAAGAAGAGGAAAATGGCAGG - Intergenic
1116897627 14:50332530-50332552 AATAAGAAGGGGGAAAAGGCAGG + Exonic
1118010070 14:61601738-61601760 TATAAGATGCGTAAAGAGGCTGG - Intronic
1118305101 14:64649110-64649132 TCTAAGAAGGGGAAATTGGCCGG + Intergenic
1118315464 14:64723206-64723228 CAGAAGAGGGGGAGAGAGGGAGG - Intronic
1119216152 14:72870776-72870798 CATTAAAAGGGTAACGAGGCTGG + Intronic
1119386764 14:74262093-74262115 CAGAAGGATGGGAAAAAGGCTGG + Exonic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120851693 14:89177661-89177683 CACAAGAACAGGAAACAGGCAGG - Intronic
1122539266 14:102488138-102488160 CATAAAAATGCAAAAGAGGCTGG - Intronic
1123023529 14:105413004-105413026 AGTAAGAAGGGGAGACAGGCAGG - Exonic
1123218668 14:106836950-106836972 GATAAGGAGGGGTAAGAGGCAGG + Intergenic
1123409967 15:20050051-20050073 TATAAGAAGGGGAAGCAGGAGGG + Intergenic
1123519299 15:21056758-21056780 TATAAGAAGGGGAAGCAGGAGGG + Intergenic
1123580727 15:21712969-21712991 TATAAGAAGGGGAAGCAGGAGGG - Intergenic
1123617376 15:22155592-22155614 TATAAGAAGGGGAAGCAGGAGGG - Intergenic
1123918434 15:25054182-25054204 CATTTGAAGGGGCAAGGGGCAGG - Intergenic
1123997206 15:25727240-25727262 CATGACAACGGGAAAAAGGCCGG - Exonic
1124041506 15:26109788-26109810 CATAAGAAGAGGAAAGCGCCCGG - Intergenic
1125184164 15:36911486-36911508 AATGAGAAGAGGAAAGAGACAGG + Intronic
1125310221 15:38371196-38371218 AAAAAGAAGGTGGAAGAGGCTGG + Intergenic
1125456861 15:39868809-39868831 CATACGAAGGGGCAGGAGCCAGG + Intronic
1125578924 15:40772375-40772397 CACAAGAGGAGGAAAGAGGGAGG - Exonic
1128012437 15:64310708-64310730 CAAAAAAAAGGAAAAGAGGCCGG + Intronic
1128018348 15:64367842-64367864 CATAAAAAGTGTAATGAGGCTGG - Intronic
1128804282 15:70519077-70519099 CATTCTAAGGGGAAAAAGGCAGG - Intergenic
1130744575 15:86637428-86637450 CAGATGAAGGTGAATGAGGCCGG + Intronic
1131546936 15:93323469-93323491 CACCAGAAGTGGGAAGAGGCAGG + Intergenic
1132097275 15:98997047-98997069 CATGAGAATGGAAAAGAGCCAGG - Intronic
1202989597 15_KI270727v1_random:447214-447236 TATAAGAAGGGGAAGCAGGAGGG - Intergenic
1132491538 16:234579-234601 GAGAAGGAGGGGAAAGAGGACGG + Exonic
1132508201 16:323141-323163 GAAAAGAAAAGGAAAGAGGCCGG + Intronic
1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG + Intronic
1132872284 16:2121068-2121090 AAGGAGAAGGGGAAAGAGCCGGG + Intronic
1132890906 16:2204207-2204229 AAGAAGAAGTGGGAAGAGGCCGG + Intergenic
1133499050 16:6348067-6348089 GCAGAGAAGGGGAAAGAGGCAGG + Intronic
1133592931 16:7263599-7263621 GATAAGAGGTAGAAAGAGGCTGG + Intronic
1133867740 16:9659756-9659778 CATGAGAAGGGGAATGAGACAGG - Intergenic
1134013520 16:10872417-10872439 CATAAGACAGGGCGAGAGGCTGG - Intergenic
1134476871 16:14581621-14581643 TATAAGAAGGGTCAGGAGGCTGG + Intronic
1134551333 16:15140147-15140169 AAGGAGAAGGGGAAAGAGCCGGG + Intergenic
1134656918 16:15954366-15954388 CATAAGGAAGGGAGAGAGGAAGG - Intronic
1134755188 16:16660760-16660782 TCTGAGAAGGGGAGAGAGGCTGG - Intergenic
1135420859 16:22304733-22304755 CTTAAGAAGGGGTGACAGGCTGG + Intronic
1135490954 16:22908980-22909002 CAGAAGAAAGGGGAAGAGCCAGG + Intronic
1135979366 16:27135271-27135293 CAGAACAAGGGGGAAAAGGCCGG + Intergenic
1136158514 16:28402254-28402276 AATAAAAAGGGAAAAGAGGCAGG - Intronic
1136204573 16:28713029-28713051 AATAAAAAGGGAAAAGAGGCAGG + Intronic
1137314823 16:47306796-47306818 AATAAAACGGAGAAAGAGGCCGG + Intronic
1137465114 16:48700696-48700718 CATCAGATGGGGGAAGAGGGAGG - Intergenic
1137575869 16:49600022-49600044 AATTAAAAGGGGCAAGAGGCCGG + Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137899762 16:52254327-52254349 AAATTGAAGGGGAAAGAGGCAGG + Intergenic
1138412890 16:56853735-56853757 CATATAAAGGGGAAAGATTCTGG + Intergenic
1138862377 16:60774308-60774330 CAAAAGAGGGAGAAAGCGGCCGG + Intergenic
1138963495 16:62055360-62055382 AAAAAGAAAGGGAAAGAAGCAGG - Intergenic
1139518010 16:67463232-67463254 CATAAAAACTGGACAGAGGCTGG + Intronic
1139808177 16:69587683-69587705 CATAAGAAGTGAAATTAGGCTGG - Intronic
1140973203 16:80033349-80033371 GAGAAAAAGGGGAAAGAGGAAGG + Intergenic
1141472091 16:84245823-84245845 AAGAAGAAGGGCAGAGAGGCAGG + Intergenic
1141489643 16:84363484-84363506 CATGAGAAGCTGGAAGAGGCAGG - Intergenic
1144067707 17:11639533-11639555 CATAAGATGATGAATGAGGCAGG - Intronic
1144247972 17:13386556-13386578 TTTAGGAAGGGGAAAGAGGAGGG - Intergenic
1145269973 17:21399614-21399636 CAAAGGAATGGGAGAGAGGCAGG + Intronic
1146062964 17:29616648-29616670 CATGAGTGGGGGACAGAGGCGGG + Intronic
1146072569 17:29697400-29697422 TACAAGAAGTGGATAGAGGCAGG + Intronic
1147336461 17:39729423-39729445 GCTAAGTAGGGGAAAGAGGCAGG + Exonic
1147943550 17:44066857-44066879 AATGAAAAGGGGAAAGAGGAGGG + Intronic
1148222156 17:45870661-45870683 CTGAACAAGGGGCAAGAGGCCGG - Intergenic
1148609621 17:48955987-48956009 AATAAGAAGAAAAAAGAGGCCGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148872973 17:50669258-50669280 CACATGAAGGTGAGAGAGGCAGG + Exonic
1149032108 17:52095790-52095812 CATCAGAAGGGAAGTGAGGCTGG - Intronic
1149395619 17:56239243-56239265 CATAAGAAATGGAGAGAGGTTGG + Intronic
1149644934 17:58233757-58233779 GCTAAGAAGGGGACAGAGGCTGG - Intronic
1150288503 17:63967633-63967655 CATAAGAAGTGGAGACAGGGCGG + Intronic
1151162913 17:72180843-72180865 CAGAAGAAGGGTTAAGATGCTGG + Intergenic
1151967799 17:77440648-77440670 CAGAAGCAGGGAGAAGAGGCAGG + Intronic
1152424766 17:80212892-80212914 TATAAGAAGCGGAAACAGGCCGG + Intronic
1152732540 17:81979425-81979447 CATGAGAAGCTGGAAGAGGCAGG - Intronic
1152930474 17:83107180-83107202 CACCAGAAGCTGAAAGAGGCAGG + Intergenic
1153017289 18:595689-595711 TATAAAAAGGGGAAAGGGGAAGG + Intergenic
1153780108 18:8486965-8486987 GATGAGAAGAAGAAAGAGGCAGG - Intergenic
1154079978 18:11246695-11246717 AATAAGAAAGGGAAAGAGACTGG + Intergenic
1155005555 18:21726081-21726103 AAAAAGAATGGAAAAGAGGCTGG + Intronic
1155148032 18:23099960-23099982 CCTAAGAAGGGGAATGAGAGCGG + Intergenic
1155389019 18:25313438-25313460 CATATGAAAGGGAAAGGGGAGGG + Intronic
1155997571 18:32346880-32346902 CCTACAAAAGGGAAAGAGGCCGG + Intronic
1156260203 18:35439248-35439270 TATAAGAAGAGGGAAGAGGCCGG + Intergenic
1156425621 18:37008859-37008881 CTTAAGAAGGGGAAAAAGAGAGG + Intronic
1156626015 18:38909920-38909942 CGAAGGAAGGGGAAAGAGGCAGG + Intergenic
1157671588 18:49533729-49533751 TATAACAATGGGAAATAGGCTGG + Intergenic
1157688542 18:49662410-49662432 GAAAAGAAGGTGAGAGAGGCTGG + Intergenic
1157990396 18:52488943-52488965 GAGAAGAAGGGGGAAGAGGCGGG - Intronic
1158571259 18:58598534-58598556 CATGAGGAGGAGAAATAGGCTGG + Intronic
1158637998 18:59178226-59178248 CGCAAGAAAGGAAAAGAGGCCGG + Intergenic
1159514476 18:69439803-69439825 CATAAGAAAGTGAAATAGCCTGG - Intronic
1159627398 18:70710626-70710648 CACCAGAAGGGGACAGAGGATGG - Intergenic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1161629031 19:5342293-5342315 AATAATAAGAGAAAAGAGGCCGG + Intergenic
1161822259 19:6537066-6537088 CATAAAAAGGAAGAAGAGGCCGG - Intergenic
1162024157 19:7884395-7884417 GAGAAGGAGGGGAAAGAGGGAGG + Intergenic
1162071796 19:8157192-8157214 AATAAGAAGTTAAAAGAGGCTGG - Intronic
1162300714 19:9843289-9843311 CAGAAGGAGGGGCTAGAGGCTGG - Intronic
1162658972 19:12154917-12154939 CATAAGACCTGCAAAGAGGCCGG + Intronic
1163755343 19:19103389-19103411 TATAAGAAGAGAAAACAGGCCGG - Intronic
1165341875 19:35218379-35218401 GATATGAAGGGCTAAGAGGCTGG - Intergenic
1165348913 19:35266318-35266340 CAGGAGAAGGGGGATGAGGCAGG - Intronic
1166234767 19:41447543-41447565 CAAAGGAAGGGGAAATAGCCGGG + Intergenic
1166301400 19:41913767-41913789 CATAAGAGGGGGAAAGGTGCGGG - Intronic
1166937822 19:46345570-46345592 CATAAGAAGGTGACAGAGCCAGG - Intergenic
1166966024 19:46529649-46529671 AATAAGAAGGGGAGGGAGGGTGG + Intronic
1167487942 19:49774127-49774149 CTTAAGAACGGGACAGATGCAGG + Intronic
1167527690 19:49995139-49995161 AGGAAGAAGAGGAAAGAGGCCGG + Intronic
1168327431 19:55545440-55545462 GAAAAGAAGGAGAGAGAGGCAGG - Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925374890 2:3377423-3377445 GATGTGAAGGGGAAGGAGGCAGG + Intronic
925678693 2:6394143-6394165 CATAAGAAAGGGAAAAATGGAGG - Intergenic
925912385 2:8582362-8582384 CAGTGGAGGGGGAAAGAGGCTGG - Intergenic
926884946 2:17588436-17588458 CATATGAGGGGGAAGCAGGCTGG - Intronic
926975049 2:18506417-18506439 AAAAAGAGGGGGAAAGAGGAAGG - Intergenic
927615502 2:24589606-24589628 CATAGGGAGAGGAAAGAGGTTGG + Intronic
927615737 2:24592917-24592939 AAAAAGAAGGGGACAGAGACAGG - Intronic
927786446 2:25978399-25978421 CTCAAGCAGTGGAAAGAGGCTGG + Intronic
927901271 2:26820595-26820617 CATAAGAGTGTTAAAGAGGCTGG + Intergenic
928118368 2:28564248-28564270 AATAAGAAGGTGAATGAAGCTGG + Intronic
928914248 2:36454909-36454931 CAGAAGGAGGATAAAGAGGCAGG + Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929298973 2:40279936-40279958 AATCAGAATGGAAAAGAGGCAGG - Intronic
929385702 2:41403699-41403721 GAGAGGAAGGGGAAAGAGGATGG + Intergenic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
931289472 2:60859551-60859573 ATTAAGAAGGGGAAAAATGCTGG + Intergenic
931881423 2:66574994-66575016 CATAATGAGGGGAAAGAGGTAGG - Intergenic
932528700 2:72502249-72502271 GATAGGATGGGTAAAGAGGCTGG + Intronic
932731347 2:74224338-74224360 ACAAAGATGGGGAAAGAGGCAGG - Intronic
933230287 2:79799203-79799225 AAGAAGAGGGGGAATGAGGCTGG - Intronic
933881130 2:86671062-86671084 TATAGGAATGGGCAAGAGGCTGG + Intronic
934650117 2:96085825-96085847 CATCAGAAAGGCAGAGAGGCAGG + Intergenic
935089213 2:99878144-99878166 AACAAGAAGCGGAAAGAGGAAGG + Intronic
935635795 2:105248816-105248838 CATGAGGAGGGGGAAGAGGAGGG + Intergenic
935847082 2:107177472-107177494 AATTTGAAGGGGAAACAGGCTGG - Intergenic
936715362 2:115180920-115180942 CTTAAGAAAGGGAGGGAGGCAGG - Intronic
936960096 2:118063998-118064020 CTCAAGTAGGAGAAAGAGGCAGG + Intergenic
936986785 2:118319147-118319169 GAAAAGAAGGGGAAAGAAGAAGG - Intergenic
937204311 2:120225762-120225784 GCCAAGCAGGGGAAAGAGGCTGG - Intergenic
937877621 2:126837297-126837319 AATCAGAAGGGGACAGAGCCTGG + Intergenic
939337478 2:140849058-140849080 CTTAAGTAGGGGAGGGAGGCCGG + Intronic
940325811 2:152423892-152423914 CAAAAGAAGAGGAAGGAGGTGGG - Intronic
940332468 2:152490178-152490200 CAAAAAAAGGGGAAAGAGGAGGG + Intronic
940644515 2:156376516-156376538 AATGAGAAAGGGAAAGAGGGAGG + Intergenic
941130524 2:161643992-161644014 TAAAAGAAGGGTAAAGAGACAGG - Intronic
941176698 2:162205806-162205828 AATAAGAAGGAGACATAGGCCGG - Intronic
941197319 2:162468841-162468863 AAAAAAAAAGGGAAAGAGGCTGG - Intronic
941772950 2:169363159-169363181 AGAAAGAAAGGGAAAGAGGCGGG + Intergenic
941944991 2:171086327-171086349 TAGAAGAAGGGAACAGAGGCTGG + Intronic
942552805 2:177137362-177137384 CAGAAGATGGGGAAAGGGGCTGG - Intergenic
943278551 2:185900202-185900224 CATTATGAGGGGACAGAGGCTGG + Intergenic
944143917 2:196485669-196485691 CATAACAAGGGGACCGAGGAAGG + Intronic
945083884 2:206112053-206112075 CATAAAAAGAGAAAACAGGCTGG - Intergenic
945243701 2:207699177-207699199 TATAAGAAGAGGAAGGTGGCTGG - Intergenic
945606833 2:211943652-211943674 AAGTAGAGGGGGAAAGAGGCAGG - Intronic
945984760 2:216344695-216344717 CATAAGGAGATGAAAGAGGGAGG + Intronic
946118103 2:217481733-217481755 CATATTAATGGGAAAGAGGGAGG - Intronic
946273631 2:218614445-218614467 AATAAAAAGAGGAAAAAGGCTGG - Intronic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
946960192 2:224976822-224976844 CAAAAGAAGGAGGAAGAGGGTGG - Intronic
947330513 2:229024907-229024929 TGTTAGAAGGGGAAAGAGGGTGG + Exonic
947639613 2:231699637-231699659 CATAACCAGGAGAAAGATGCTGG + Intergenic
947799165 2:232916991-232917013 CACCAGATGGGGAGAGAGGCGGG - Intronic
948057488 2:235019363-235019385 CAGAAGAAAGGGAGAGATGCAGG + Intronic
948654868 2:239470345-239470367 CATAAAGAGCAGAAAGAGGCTGG - Intergenic
948664941 2:239528909-239528931 CATAAGAAGGCAGGAGAGGCAGG - Intergenic
948767385 2:240230240-240230262 AAGACGATGGGGAAAGAGGCTGG + Intergenic
1168731132 20:82021-82043 TAAAAGAAGGAGAAATAGGCTGG + Intergenic
1169034596 20:2439184-2439206 CATAAGAGGTGGAAAGATTCTGG + Intergenic
1169187363 20:3630014-3630036 TCCAAGAAGGGGAAAGGGGCTGG - Intronic
1169188601 20:3642161-3642183 CACAAGAAGGGGACAAAGGCAGG - Intronic
1169924941 20:10773339-10773361 CAAAAGATGAGGAAAGAGGGAGG - Intergenic
1172134994 20:32680908-32680930 CATCAGAGAGGGAAAGAGGAAGG - Intergenic
1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG + Intergenic
1172603726 20:36200830-36200852 CAGAGGAAAGGGAAAGAGGGAGG - Intronic
1172761607 20:37327354-37327376 CAGAAGAAGGCCAAAGAAGCTGG - Intergenic
1173134812 20:40430128-40430150 TAAAACAAGAGGAAAGAGGCCGG + Intergenic
1173248762 20:41353648-41353670 CATGAGTAGGGGAAGGTGGCTGG - Intronic
1173871422 20:46344417-46344439 CATGAGGAGGGGGAAGAGGGAGG - Intergenic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1175019268 20:55827038-55827060 CAGAAGAAGGGGTTAGAGGAAGG - Intergenic
1175534841 20:59702323-59702345 CAAAAGAACAGGAAGGAGGCTGG - Intronic
1175849756 20:62083512-62083534 AAAAAGAAGGGGAGAGAGGGAGG - Intergenic
1175979740 20:62732243-62732265 CCTAAGATAGGGAAGGAGGCAGG - Intronic
1176172848 20:63703913-63703935 CACAAGGAGGGGGAAGAGGGAGG + Intronic
1176286387 21:5021345-5021367 AATAAGAAGGCGGAAGAGACGGG - Intergenic
1177172215 21:17667380-17667402 CCTAATCAGGGGAAAGAGTCTGG - Intergenic
1178270608 21:31186215-31186237 CTAAAGAAGGGGAGGGAGGCTGG + Intronic
1178321950 21:31612676-31612698 CAAAAGAAGGGGAACGAGGCAGG - Intergenic
1178925629 21:36772686-36772708 CTCAAGAAGGTGGAAGAGGCCGG + Intronic
1179619144 21:42601204-42601226 CTTTAGAACAGGAAAGAGGCCGG + Intergenic
1179870794 21:44242130-44242152 AATAAGAAGGCGGAAGAGACGGG + Intergenic
1179876326 21:44270455-44270477 AAAAAAAAGAGGAAAGAGGCCGG - Intergenic
1181742070 22:24929143-24929165 CAAAAGAAGGGGAGAGAGAAGGG - Intergenic
1182424830 22:30266467-30266489 AATAGGATGGGCAAAGAGGCTGG - Intronic
1183706715 22:39478876-39478898 CACAAGAAGTGGGAAGAGGGAGG + Intronic
1183772347 22:39938050-39938072 CATAAGAAGAAGGAAGTGGCTGG + Intronic
1183963061 22:41424266-41424288 CACAAGAAAAGGAAATAGGCTGG - Intergenic
1184338207 22:43868316-43868338 TATAAGAGGGGAAAAGAAGCTGG + Intergenic
1185006033 22:48277460-48277482 CAGAAGAAGGTGGGAGAGGCTGG + Intergenic
1185074388 22:48675503-48675525 CAGCAAAAGGGGAAATAGGCTGG + Intronic
1185256517 22:49836343-49836365 CACCAGAAGCCGAAAGAGGCAGG + Intergenic
949825750 3:8163411-8163433 ATTAAGAAGGAGATAGAGGCAGG + Intergenic
950884671 3:16353036-16353058 CACAGGAGGAGGAAAGAGGCAGG + Intronic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
952146351 3:30536925-30536947 AATAAAAAGGGAAAAGAGGAGGG + Intergenic
952395248 3:32915334-32915356 AATAAAAATGAGAAAGAGGCCGG - Intergenic
952875575 3:37941711-37941733 GATAAGGAGGAGAAAGAGGGTGG + Intronic
953251676 3:41249750-41249772 CTGACCAAGGGGAAAGAGGCAGG + Intronic
953622518 3:44545552-44545574 CATCAAAAGGGGAAAGAGAAGGG - Intergenic
955299782 3:57766519-57766541 CCTGAGAAGAGGAAAGAGTCTGG - Intronic
955793799 3:62614311-62614333 CATAAGATGGGGACAGGGGGAGG - Intronic
955902668 3:63774093-63774115 TATAAGAAGGAGAAACTGGCCGG + Intergenic
956107539 3:65836522-65836544 CTAAAGAAAGGGAAAGAGGCCGG + Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956287885 3:67629629-67629651 TCTAAGTAGGGGAGAGAGGCTGG - Intronic
956540008 3:70326159-70326181 CAGAAGGAAGGGAAAGAGGAAGG - Intergenic
956660196 3:71589899-71589921 TATGAGAAGGGAAATGAGGCAGG + Intergenic
956922456 3:73944339-73944361 CAAAAGTAAAGGAAAGAGGCAGG + Intergenic
957245616 3:77712267-77712289 CATCATGAGGGGAAAGAGGAGGG - Intergenic
957720206 3:83985546-83985568 AATAAAAAGTGAAAAGAGGCTGG - Intergenic
957946627 3:87071366-87071388 GATAAGAAGGAGGAAAAGGCAGG - Intergenic
960216088 3:115039224-115039246 CCTAAGAAGGGGGAAGAGGAAGG + Intronic
960296087 3:115945661-115945683 CATTAGAAGGGAAAAGTGGTTGG - Intronic
961456044 3:127024483-127024505 CATAGGAAGGGGACACAGGGAGG + Intronic
961981568 3:131084635-131084657 CATATGATAGGGAAAAAGGCAGG + Intronic
962276054 3:134014329-134014351 CTTCAGCAGGGCAAAGAGGCTGG + Intronic
962300879 3:134242003-134242025 TATAAGAATGAGAATGAGGCCGG + Intronic
963970945 3:151429109-151429131 GACAAGAAGGGGAGAGAGGTAGG + Intronic
964487419 3:157200124-157200146 GAAATGAAGGGGAAAAAGGCTGG + Intergenic
965938051 3:174139623-174139645 AATAAAAAGGGGAAAAATGCTGG + Intronic
966715459 3:183009662-183009684 GATAAGAAGGTGAAACAGCCAGG - Intergenic
966826343 3:183968031-183968053 CAGCAGAATAGGAAAGAGGCTGG - Intronic
967105976 3:186255400-186255422 TATAAGAAGGTGACTGAGGCTGG + Intronic
967800300 3:193651074-193651096 CATAAATGGGGGCAAGAGGCAGG + Intronic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
968056251 3:195694151-195694173 AATGAGAACGGGAAAGAGGGAGG + Intergenic
968875779 4:3267210-3267232 TTTAAAAAGGTGAAAGAGGCCGG + Intronic
969225503 4:5795353-5795375 CATCAGAAGAGGATGGAGGCTGG + Intronic
969595622 4:8147977-8147999 CAGAAGAAGGGGCACGAGTCAGG + Intronic
970354239 4:15236407-15236429 CGTGAGAAGGGGAAAGGGGCTGG + Intergenic
970867220 4:20772928-20772950 AATAAGAAAGGGAAAGGGGCCGG - Intronic
972822034 4:42713036-42713058 CAAAAGAAGGGGAAAGGAGGAGG + Intergenic
974713114 4:65629338-65629360 CATAATAACTGGATAGAGGCAGG + Intronic
975131086 4:70833813-70833835 TATGAAAAGGGGAAAAAGGCTGG - Intronic
975801736 4:78067233-78067255 CATTAAAAGGGGAAAGAGTATGG - Intronic
976199598 4:82564986-82565008 TATAAAAAGGAGTAAGAGGCCGG - Intergenic
977001553 4:91511025-91511047 CATATGCAGAAGAAAGAGGCTGG - Intronic
977748497 4:100580127-100580149 GATCTGAAGGGGAAAGAGACAGG + Intronic
978665710 4:111178574-111178596 CAAGAGAAGGAGAAAGAAGCAGG - Intergenic
979715217 4:123829603-123829625 CATTAGAAGCTGAAAGAAGCAGG + Intergenic
979931388 4:126636026-126636048 CATGAGAAGCTGAAAGAGGAAGG - Intergenic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
980265863 4:130514884-130514906 ATTAGAAAGGGGAAAGAGGCCGG + Intergenic
980613303 4:135185401-135185423 CATAGGCAGGGGAAGGAGCCTGG - Intergenic
980619947 4:135288023-135288045 CATAAGAAGGGTATTTAGGCAGG - Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
980882329 4:138724558-138724580 ATAGAGAAGGGGAAAGAGGCAGG - Intergenic
980985502 4:139690963-139690985 CAGAAGAACTGGAAAGAGTCTGG - Intronic
982363156 4:154545155-154545177 CATAAGGAGGGTAGAGAGCCTGG + Intronic
982856748 4:160392444-160392466 CATAAAAAGTGAAAAGAGACAGG + Intergenic
982909487 4:161121136-161121158 CTGAAGCAGGGAAAAGAGGCTGG + Intergenic
983092138 4:163516348-163516370 CATAAGGAGGGGAGAGGGGATGG - Intronic
983686496 4:170415579-170415601 CATAATCAGGAGAAACAGGCAGG + Intergenic
983690809 4:170466120-170466142 CCTAAGGAGGTGAAAGAGGGAGG - Intergenic
984004307 4:174290148-174290170 ATTAAGAAGAAGAAAGAGGCAGG - Intronic
984131058 4:175876906-175876928 GATAAGAAGGGTCAAGAGACTGG + Intronic
984314600 4:178111498-178111520 AATAAATATGGGAAAGAGGCAGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984847932 4:184123379-184123401 CATAATCAGAGCAAAGAGGCTGG - Intronic
985177336 4:187215569-187215591 AATAAGAAAGGGATGGAGGCCGG - Intergenic
985273838 4:188219021-188219043 CAGAAGAAGGTGCAAGCGGCTGG - Intergenic
986095117 5:4547102-4547124 GAAAAGAAAGAGAAAGAGGCTGG + Intergenic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
987095434 5:14545518-14545540 CGCAAGAAGGGGAAGGAGGGAGG - Intergenic
988841355 5:35086948-35086970 GAGAAGATGGGGAAAGAGGAAGG - Intronic
989026663 5:37075945-37075967 CTTAAGAAATGGAAACAGGCTGG + Intergenic
989518102 5:42367081-42367103 CATAAGAGGAGAAAAGATGCAGG - Intergenic
989708863 5:44372197-44372219 CACCAGAAGCTGAAAGAGGCAGG - Intronic
990527288 5:56640473-56640495 CAGCAGAAGAGGCAAGAGGCTGG + Intergenic
991247428 5:64522957-64522979 GATGTGAGGGGGAAAGAGGCAGG + Intronic
991440127 5:66638403-66638425 TATAATGAGGGGAGAGAGGCAGG - Intronic
991508111 5:67346037-67346059 TATACAAAGGGGAAAGAGGAAGG + Intergenic
991530017 5:67604668-67604690 CACATGAAGGGGCAAGAGGAAGG - Intergenic
991705778 5:69357060-69357082 AATATTAAGGGGAAAGAGGTGGG - Intronic
992518495 5:77522343-77522365 TAAAAGAAACGGAAAGAGGCCGG + Intronic
992667126 5:79021458-79021480 CAACAGCAGGGGAAGGAGGCTGG + Intronic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
993730234 5:91413469-91413491 CATAAGACGAAGAAAAAGGCTGG + Intergenic
994598718 5:101873700-101873722 CATAAAAAGGTGAGAGAGGATGG + Intergenic
996063629 5:119058088-119058110 ATTAAGACGGGGAATGAGGCTGG + Intronic
996422704 5:123279562-123279584 CAGAAGAAGGGGACAGAGAATGG - Intergenic
996793830 5:127322330-127322352 CAGAGGAAAGGCAAAGAGGCAGG - Intronic
997170391 5:131713340-131713362 TTTAAGAAGGGGTACGAGGCCGG - Intronic
997507578 5:134430205-134430227 CAGAGGGAGGGGAAAGAGGTGGG + Intergenic
997649966 5:135509649-135509671 TAAAAGGAGGGGAAAGAGGCAGG - Intergenic
997923563 5:138006191-138006213 AAAAAGAAGAGGAAATAGGCCGG - Intronic
1000055499 5:157602577-157602599 CAGAAGAAGGGGGATGAGGAAGG + Intergenic
1000598868 5:163248297-163248319 CAGAAGAAGGTGGAAGAAGCTGG + Intergenic
1001040728 5:168333244-168333266 GAGGAGAAAGGGAAAGAGGCGGG - Intronic
1001235630 5:170026973-170026995 CATATGAATGGGAAAGTGTCAGG + Intronic
1001575193 5:172758639-172758661 CATGAGGAAGGGAAAGAGGCTGG + Intergenic
1002357298 5:178641218-178641240 GTTAAGACTGGGAAAGAGGCTGG + Intergenic
1003009942 6:2417271-2417293 CATCAGAAGCTGGAAGAGGCAGG + Intergenic
1003105355 6:3211103-3211125 CATAAGATGAGGTTAGAGGCCGG - Intergenic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1003247878 6:4399688-4399710 CCTATGAAGGGGGAAGAGGCTGG - Intergenic
1003286597 6:4739655-4739677 CATAAAAAGGTGATTGAGGCCGG + Intronic
1003638307 6:7854953-7854975 GGTAAGAGGGGGAAAGAGGATGG - Intronic
1004058049 6:12161173-12161195 TCTCAGAAGGGGAATGAGGCAGG - Intronic
1004164399 6:13243114-13243136 CAAAAGAATGGGAATGAGTCAGG + Intronic
1004330309 6:14715037-14715059 CACAGGGAAGGGAAAGAGGCTGG - Intergenic
1004971459 6:20915220-20915242 CCTAAGACTGGGAAATAGGCAGG - Intronic
1005159222 6:22838835-22838857 CATACAAAGGAGGAAGAGGCAGG + Intergenic
1005783244 6:29215953-29215975 CACAAGAAGGTGAGAGATGCAGG - Intergenic
1006207586 6:32361993-32362015 CATAAGAAGAGGAACGGGCCGGG + Intronic
1006338740 6:33434165-33434187 CAGAAGCAGGGGAAAGAGTGAGG - Intronic
1006430785 6:33994327-33994349 CACAAGGAGAGGAAAGAGGCAGG + Intergenic
1007615516 6:43177617-43177639 ATTAAGAAGGAGAGAGAGGCCGG + Intronic
1009361499 6:62819802-62819824 CGTAAGAAGGGTAAGGAGTCAGG + Intergenic
1009395992 6:63201783-63201805 AATTAAAAGGGGCAAGAGGCTGG + Intergenic
1009883070 6:69593228-69593250 CATCAGAAAGGGAAAGTGGGAGG + Intergenic
1010420486 6:75669051-75669073 AATAATAAGGGAAAATAGGCCGG + Intronic
1011101957 6:83732010-83732032 GAAAACAAGGGGAAAGAGACAGG + Intergenic
1011205291 6:84887518-84887540 AATGAGAAGGGGAAAGCAGCAGG - Intergenic
1011371291 6:86639577-86639599 GAAAAGAAGGGGAAAAAGGGAGG + Intergenic
1011866458 6:91834716-91834738 CACCAGAAGCTGAAAGAGGCAGG + Intergenic
1011947910 6:92930255-92930277 AGAAAGAAGGGGAAAGAGCCAGG + Intergenic
1013007824 6:106090558-106090580 CTTTAGAAGGTGAAAGAGGATGG + Intronic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1014401762 6:120998465-120998487 TATAAGAATGGGAAAGGGGCCGG - Intergenic
1014490604 6:122057197-122057219 CAGATAAAGGGGAGAGAGGCAGG + Intergenic
1015102376 6:129496460-129496482 CAAAAGAAGGGGAAATAGGCCGG - Intronic
1015437677 6:133208410-133208432 AATTGGAAGGGGAAAGAGGCAGG - Intergenic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1016198116 6:141371465-141371487 CATAAGAAAGTGAAAAATGCAGG - Intergenic
1016267154 6:142245993-142246015 CATAAGACGAGTAAAAAGGCTGG - Intergenic
1016389220 6:143558393-143558415 CATAGTAACGGGAAAGAGGTAGG - Intronic
1017010465 6:150059831-150059853 CATAAGATGTGCAAAGAAGCAGG - Intergenic
1017465945 6:154693792-154693814 GAAAAGAAGGGGCAAGAGGGAGG + Intergenic
1017634438 6:156430317-156430339 TAGAGGAAGGGGAAAGAGACAGG + Intergenic
1017718816 6:157230867-157230889 CCTAAGAAGGGCAAAGCGGTTGG - Intergenic
1018959466 6:168437480-168437502 CTTAAGAAGGAAGAAGAGGCCGG + Intergenic
1018970524 6:168525721-168525743 CATGTGAAGGTGGAAGAGGCAGG + Intronic
1020088718 7:5325226-5325248 AAGAAGAAAGGGAAAGAGGCTGG - Exonic
1020423229 7:8034723-8034745 AAAAAGAAGGAAAAAGAGGCTGG + Intronic
1021545840 7:21812215-21812237 CATAAGATGGGGAAATAGATTGG + Intronic
1022166232 7:27765530-27765552 CTTTACAATGGGAAAGAGGCTGG - Intronic
1022257944 7:28678089-28678111 TGTAAGAATGGAAAAGAGGCTGG + Intronic
1023159754 7:37285673-37285695 CAAAAGAAGGGGAAAAAAGCAGG + Intronic
1023250471 7:38254893-38254915 CAAAAGAAGGAGAAAAAGGTAGG - Intergenic
1023251772 7:38270992-38271014 CAAAAGAAGGAGAAAAAGGTAGG - Intergenic
1023554800 7:41410077-41410099 CTTAAGGAGGTGAAAAAGGCTGG + Intergenic
1024246175 7:47472034-47472056 CCTGAGAAGGTGGAAGAGGCAGG - Intronic
1024393108 7:48837495-48837517 CATGTGAAGTGGAAGGAGGCTGG - Intergenic
1024408424 7:49010084-49010106 CATTAGAAGTGAATAGAGGCAGG - Intergenic
1026339810 7:69425337-69425359 CATAAAAAGTGAAGAGAGGCCGG - Intergenic
1026639617 7:72112952-72112974 CAAGAGAAGGGTAAACAGGCAGG + Intronic
1026772388 7:73210832-73210854 CCTATGATGGGGAAAGAGGAAGG + Intergenic
1026870812 7:73850294-73850316 GATAAGGAGAGGAAAGAAGCTGG - Intergenic
1027013256 7:74764231-74764253 CCTATGATGGGGAAAGAGGAAGG + Intergenic
1027074784 7:75181803-75181825 CCTATGATGGGGAAAGAGGAAGG - Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028633901 7:92965942-92965964 CATAAAATGTAGAAAGAGGCTGG + Intergenic
1029206270 7:98870892-98870914 ATCAAGAAGGGGCAAGAGGCTGG - Intergenic
1029870963 7:103692424-103692446 AAGAAGAAGAGGCAAGAGGCAGG - Intronic
1029933511 7:104398703-104398725 CATAATAAGGTGAGACAGGCAGG - Intronic
1030099336 7:105931347-105931369 GAGAGGAAGGGGAAAGAGGAGGG - Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1031333757 7:120499755-120499777 TATGTGAAGGGCAAAGAGGCAGG - Intronic
1032404356 7:131644910-131644932 AATAAGAAGGGGAATAAGGGAGG - Intergenic
1032709429 7:134449288-134449310 GATAAGAAGAGCAAACAGGCCGG + Intronic
1033075277 7:138244123-138244145 CATTAGAATGGGAAGGAGGAAGG - Intergenic
1033585368 7:142770848-142770870 CATAGGAAGGGGAAAGCTGCAGG + Intergenic
1034045522 7:147923299-147923321 CATGAGAAGAGGAAAGACACAGG + Intronic
1034227831 7:149497208-149497230 CAGAAGGAGGGGACAGCGGCTGG + Intronic
1034944920 7:155255652-155255674 AAGAAGAAGGGGAAAGGGGAAGG + Intergenic
1035562328 8:615234-615256 AATAAGAAGAGGAAAGAGAGAGG - Intronic
1036056953 8:5265945-5265967 AATAAGAAAGGTAAAGAGGAGGG + Intergenic
1036131905 8:6123282-6123304 CAGAAGAAGGTGGAAGAAGCAGG - Intergenic
1036448339 8:8842967-8842989 TCTAAGAAAGCGAAAGAGGCCGG + Intronic
1037560835 8:20073140-20073162 CTAAGGAAGGGGAGAGAGGCTGG - Intergenic
1037952081 8:23025680-23025702 AATAAGAAGGGCCAAAAGGCTGG + Intronic
1038534337 8:28343190-28343212 CCCTAGAAGGGGCAAGAGGCGGG - Exonic
1039279405 8:35967155-35967177 CATAAAAAGAGAAAAGAGGTGGG - Intergenic
1039345371 8:36698122-36698144 CACTAGTAGGAGAAAGAGGCGGG + Intergenic
1040068150 8:43165638-43165660 GATAAGAAAGTGAAACAGGCTGG + Intronic
1040564804 8:48555894-48555916 CAAAAGAAAGAGAAAGAGGAGGG - Intergenic
1041120206 8:54578917-54578939 TCTAAGAAGGGGGATGAGGCAGG - Intergenic
1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG + Intergenic
1041751492 8:61265797-61265819 CATAAGATGGGAAAGAAGGCAGG - Intronic
1042426871 8:68659355-68659377 CAGAAGGAGGCAAAAGAGGCTGG - Intronic
1042437596 8:68785338-68785360 GATAAGCAGGGGAAAGAGACTGG - Intronic
1044245086 8:89934543-89934565 CAACAGAAGGGACAAGAGGCTGG - Exonic
1045182320 8:99797638-99797660 CATAAGGAGGCCAAAGGGGCAGG - Intronic
1045997618 8:108381827-108381849 CATAAGAAGAGAAAGGAGACAGG + Intronic
1046281376 8:112037011-112037033 CATATGAAGAGGAAAGGGACAGG - Intergenic
1047376346 8:124300920-124300942 ATTCAGAAAGGGAAAGAGGCCGG - Intergenic
1047948846 8:129910952-129910974 CAAAACAATGGGAGAGAGGCCGG - Intronic
1048413802 8:134203866-134203888 AATAAAAAGTGGAAGGAGGCTGG - Intergenic
1048446026 8:134493939-134493961 ACTAAGAAAGGGAAGGAGGCAGG + Intronic
1049382163 8:142322350-142322372 CGTAAGATGGGGAACAAGGCAGG + Intronic
1050603423 9:7275357-7275379 CAGAAGAAGGGAAAAGAGCTGGG - Intergenic
1050631274 9:7561222-7561244 CAAAGGAGGGGCAAAGAGGCTGG - Intergenic
1052556221 9:30021306-30021328 GATAAGAAAGGGGAAGAGTCTGG - Intergenic
1052813544 9:33082625-33082647 GATAAAATGGGGAACGAGGCTGG - Intergenic
1052900648 9:33791921-33791943 CAGAAGGAGGGGCAAGGGGCAGG + Intronic
1053466813 9:38314616-38314638 AAGAAGGAGGGGAAAGAGGGAGG - Intergenic
1056186708 9:84142165-84142187 CACCAGAAGGTGGAAGAGGCGGG + Intergenic
1056739976 9:89246082-89246104 CATAAGAAGGCAAATGAGGCTGG + Intergenic
1057383744 9:94590338-94590360 CATAAGAAGAGGAAAGAGAAGGG + Intronic
1057622025 9:96644774-96644796 CATAAGATTGGGATTGAGGCCGG - Intronic
1058774901 9:108273400-108273422 CAAAAGAAGTGGAAAGTGGTTGG - Intergenic
1059139331 9:111837366-111837388 AAGAAGAAAGGGAAAGAGACAGG - Intergenic
1059530362 9:115030061-115030083 CAAAAGAATGGGAAACACGCTGG - Intronic
1059681490 9:116590450-116590472 AATAAGCACGGGAAAGGGGCTGG + Intronic
1059729855 9:117045927-117045949 CTTAGGATGGGGAAAGAGGCTGG + Intronic
1060443312 9:123662271-123662293 CAAAAGAAGAATAAAGAGGCTGG + Intronic
1060473241 9:123965980-123966002 CAGAAGAAGGGGAAAGATCTGGG - Intergenic
1061440526 9:130600120-130600142 GAAAAGAGGGGGAAAGAGGGAGG - Intronic
1062160927 9:135079323-135079345 AAGAAGAAGAGGACAGAGGCTGG + Intronic
1062357857 9:136173517-136173539 CATCAGAAGCTGGAAGAGGCAGG + Intergenic
1185975882 X:4719577-4719599 CAGAAGAAAGGTAAAGGGGCAGG - Intergenic
1186125547 X:6409943-6409965 CATGAGGAGGAGAAAGAGGTAGG + Intergenic
1187085662 X:16040633-16040655 CATCCAAAGGGTAAAGAGGCTGG + Intergenic
1187252582 X:17612325-17612347 CAGAACCGGGGGAAAGAGGCAGG - Intronic
1188311128 X:28617784-28617806 AATTTGAATGGGAAAGAGGCAGG + Intronic
1188955095 X:36424831-36424853 CATAAGAAGGAAAATGAGGTTGG + Intergenic
1189724285 X:43952966-43952988 CATAAGCAAAGGCAAGAGGCAGG - Intronic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190956444 X:55199372-55199394 CAAAGGAAGGGGACAGAGACAGG + Intronic
1191690363 X:63932880-63932902 GAGATGAAGGGGCAAGAGGCTGG - Intergenic
1192531937 X:71895591-71895613 GAAAAGAAAAGGAAAGAGGCAGG + Intergenic
1192777809 X:74263338-74263360 CATAAGAATGAGTATGAGGCCGG + Intergenic
1193275333 X:79579841-79579863 CAGAAGAAAGAGAAAGAAGCAGG - Intergenic
1194419585 X:93657157-93657179 TGTAAGAAGGGAAAAGAAGCTGG - Intergenic
1194655623 X:96569848-96569870 CATCAGAAGTGAAAATAGGCCGG - Intergenic
1194849825 X:98856901-98856923 CATAAGAAGCTGACAGAGCCAGG - Intergenic
1195329463 X:103785553-103785575 AAGAAGAAGGGGAAACAGTCAGG - Intronic
1195369718 X:104161551-104161573 AAAAAGAAGAAGAAAGAGGCTGG + Intergenic
1195597547 X:106709840-106709862 CATAAGAAGTTAAAACAGGCTGG - Intronic
1197872104 X:131070372-131070394 GATGAGAAGGGGGATGAGGCAGG + Intronic
1198503156 X:137273232-137273254 CATAAGGGAGGGAAAGGGGCAGG - Intergenic
1199572063 X:149276187-149276209 AATGAGAAAGGGAAGGAGGCAGG - Intergenic
1201412742 Y:13716981-13717003 GATAAGAAGGAGAAAGAGAATGG + Intergenic
1201979765 Y:19893679-19893701 CTCAAGAAGGTGAGAGAGGCTGG - Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic