ID: 1132697371

View in Genome Browser
Species Human (GRCh38)
Location 16:1207940-1207962
Sequence TCCCTAGGTTGGGGGATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 626}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132697363_1132697371 -9 Left 1132697363 16:1207926-1207948 CCCCCATAAGGCAATCCCTAGGT 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1132697371 16:1207940-1207962 TCCCTAGGTTGGGGGATTCCTGG 0: 1
1: 0
2: 1
3: 23
4: 626
1132697361_1132697371 1 Left 1132697361 16:1207916-1207938 CCGGGCAGGGCCCCCATAAGGCA 0: 1
1: 0
2: 0
3: 23
4: 168
Right 1132697371 16:1207940-1207962 TCCCTAGGTTGGGGGATTCCTGG 0: 1
1: 0
2: 1
3: 23
4: 626
1132697364_1132697371 -10 Left 1132697364 16:1207927-1207949 CCCCATAAGGCAATCCCTAGGTT 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1132697371 16:1207940-1207962 TCCCTAGGTTGGGGGATTCCTGG 0: 1
1: 0
2: 1
3: 23
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132697371 Original CRISPR TCCCTAGGTTGGGGGATTCC TGG Intronic
901416684 1:9121377-9121399 TCCCTAAGTTCTGGGATTACAGG - Intronic
901557328 1:10041951-10041973 TCCCAAAGTTGTGGGATTACAGG + Intronic
901718673 1:11177297-11177319 TCCCAAGGTGGTGGGATTACAGG - Intronic
901750588 1:11404952-11404974 TCCCTAAGTACGGGGATTACAGG + Intergenic
901805232 1:11734662-11734684 TTCCTAGGGTGGGGGAAACCAGG - Intergenic
901917207 1:12508841-12508863 TCCCCAGGATGGGGAAATCCAGG - Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902820295 1:18939194-18939216 TCCCTGGGTTGGCAGATTCCTGG - Intronic
902960133 1:19957462-19957484 TCCCAAATTTGGGGGATTTCTGG + Intergenic
903040702 1:20527920-20527942 TCCCTAAGTAGCGGGATTACAGG - Intergenic
903531948 1:24037709-24037731 TCCCTAAGTTTTGGGATTACAGG + Intergenic
904219248 1:28951593-28951615 TCCCAAAGTGGGGGGATTACAGG - Intronic
904475970 1:30764763-30764785 TCCCGAGGTTCTGGGATTACAGG + Intergenic
904917946 1:33983892-33983914 TCCCTTGGTGCTGGGATTCCAGG - Intronic
906172455 1:43738754-43738776 TCCCAAAGTGGTGGGATTCCAGG + Intronic
906173851 1:43752073-43752095 TCCCTAAGTGCGGGGATTACAGG + Intronic
908587412 1:65585885-65585907 TAACAAGGTTGGTGGATTCCAGG + Intronic
909098022 1:71314067-71314089 TCCCAAAGTTCTGGGATTCCAGG + Intergenic
909635433 1:77812053-77812075 TCCCTAAGTTATGGGATTACAGG - Intronic
909646421 1:77922024-77922046 TCCCAAAGTTGGGGGAATACAGG + Intronic
910530208 1:88227205-88227227 TCCCTGGGCAGTGGGATTCCTGG - Intergenic
911190144 1:94940551-94940573 TCCCAAAGTTTGGGGATTACAGG - Intergenic
911349299 1:96733418-96733440 TCCCTAAGTTCTGGGATTACAGG - Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912542293 1:110426096-110426118 TGCCTGGGTTGGGGGATGGCAGG + Intergenic
912914476 1:113799299-113799321 TCCCTAAGTTCTGGGATTACAGG + Intronic
914390883 1:147222109-147222131 TCCCAAGGTGTGGGGATTACAGG - Intronic
915191230 1:154152430-154152452 TCCCAAAGTGGGGGGATTACAGG + Intronic
915542554 1:156577424-156577446 TCCCAAAGTTGTGGGATTACAGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916656667 1:166882784-166882806 TCCCTAAGTGGTGGGATTACAGG + Intergenic
916809267 1:168291331-168291353 CCCCAAAGTTGGGGGAGTCCGGG - Exonic
916875605 1:168965112-168965134 TCCCTAAGTTTTGGGATTACAGG - Intergenic
917943295 1:179944848-179944870 TCCCAAAGTTGTGGGATTACAGG + Intergenic
917952805 1:180057796-180057818 TCCCTAGGTTGGGGCTCTCCAGG + Intronic
918911035 1:190569946-190569968 TCCCAAAGTTTTGGGATTCCAGG + Intergenic
919523097 1:198613602-198613624 TCCCTAAGTTCTGGGATTACAGG + Intergenic
919663227 1:200268400-200268422 TCCCAAAGTTGTGGGATTACAGG - Intergenic
920166862 1:204042202-204042224 TCCCCTGGTGAGGGGATTCCAGG + Intergenic
920513948 1:206570350-206570372 TCCCTAAGTTCTGGGATTACAGG + Intronic
921832806 1:219747079-219747101 TCCCTAAGTTTTGGGATTACAGG - Intronic
921884873 1:220295587-220295609 TCCCAAAGTGGGGGGATTACAGG + Intergenic
922319280 1:224471286-224471308 TCCCAAGGTGCTGGGATTCCAGG + Intronic
922421980 1:225466297-225466319 TCCCAAGGTGCTGGGATTCCAGG - Intergenic
922434621 1:225591506-225591528 TCCCAAAGTTCTGGGATTCCGGG - Intronic
922449803 1:225727769-225727791 TCCCGAGGTGGTGGGATTACAGG + Intergenic
923514019 1:234679277-234679299 TCCCTTGGGTGGTGGATACCTGG + Intergenic
924001041 1:239552747-239552769 TCCCAAGGTTTTGGGATTGCAGG + Intronic
924110641 1:240696046-240696068 TCCCAAAGTGGGGGGATTACAGG + Intergenic
1063361914 10:5466358-5466380 TCCCCAGGTTGGTTGACTCCAGG - Intergenic
1064175781 10:13073743-13073765 TCCCTAGGTGCTGGGATTACAGG + Intronic
1064198522 10:13265038-13265060 TCCCAAAGTTCTGGGATTCCAGG + Intergenic
1064216421 10:13404498-13404520 TCCCAAAGTTGGGGGATTATTGG - Intergenic
1064292038 10:14044085-14044107 TCCCTAGGTGCTGGGATTACAGG + Intronic
1065019528 10:21493429-21493451 TCCCTAGGTGCTGGGATTACAGG - Exonic
1065105372 10:22378320-22378342 TCCCTAAGTTCTGGGATTACAGG + Intronic
1065215425 10:23443757-23443779 TCCCAAGGTGGTGGGATTACAGG + Intergenic
1065356721 10:24849501-24849523 TAACTAGGTGGGGGTATTCCTGG + Exonic
1065495700 10:26325438-26325460 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1067962995 10:50877862-50877884 TCCCAAAGTGGGGGGATTACAGG - Intronic
1068236102 10:54234427-54234449 TCCCTAAGTTCTGGGATTACAGG - Intronic
1068690666 10:59910415-59910437 TCCCAAAGTAGGGGGATTACAGG + Intergenic
1069394574 10:67974930-67974952 TCCCAAGGTTCTGGGATTACAGG - Intronic
1069629371 10:69888569-69888591 TCCCTAGAATGGGTGATTCTGGG + Intronic
1070199854 10:74193524-74193546 TCCCTAGGTTCTAGGATTACAGG - Intronic
1070352135 10:75602589-75602611 TATCTAGGTAGGGGGATTACTGG + Intronic
1071078415 10:81782077-81782099 CCACTAGGTTGGGGCATACCTGG - Intergenic
1071948146 10:90671603-90671625 TCCCAAGGTGGTGGGATTACAGG - Intergenic
1072168968 10:92842100-92842122 TCCCAAAGTGGTGGGATTCCAGG - Intronic
1072387564 10:94946856-94946878 TCCCAAAGTTGTGGGATTACAGG - Intronic
1072548587 10:96459368-96459390 TCCCTAAGTTCTGGGATTACAGG - Intronic
1073236866 10:102024190-102024212 TCCCTAAGTGCTGGGATTCCAGG - Intronic
1073365016 10:102932657-102932679 TCCCAAGGTTCCGGGATTACAGG - Intronic
1073436863 10:103522347-103522369 TCCCAAGGTTCTGGGATTACAGG - Intronic
1073521447 10:104134137-104134159 TCCCAAGGTGGTGGGATTACAGG - Intronic
1074874940 10:117606428-117606450 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1075026700 10:118990169-118990191 TCCCAAAGTTGCGGGATTGCAGG + Intergenic
1075142139 10:119848351-119848373 TCCCAAAGTTCTGGGATTCCAGG - Intronic
1075808484 10:125207177-125207199 TCCCAAGGTTTTGGGATTACAGG + Intergenic
1076461966 10:130653932-130653954 TCCCAAAGTGGGGGGATTACAGG - Intergenic
1077033459 11:481118-481140 TCCCAAAGTGCGGGGATTCCAGG + Intronic
1077308708 11:1879084-1879106 TCCCAAGGTGGTGGGATTACAGG - Intronic
1077579168 11:3405738-3405760 TCCCTAAGTGCTGGGATTCCAGG + Intergenic
1077866303 11:6224233-6224255 TCCCTAGGTGGTGCGAATCCTGG - Exonic
1077897288 11:6462946-6462968 TCCCAAAGTTCTGGGATTCCAGG - Intronic
1078078160 11:8180395-8180417 TCCCTAGGGTGGGAGATGGCAGG + Intergenic
1078697900 11:13652839-13652861 TTGCTAGGTTGGGGAACTCCTGG - Intergenic
1078769900 11:14339853-14339875 TCCCAAGGTGGTGGGATTACAGG - Intronic
1079087082 11:17454244-17454266 TCCCTAGAGTCAGGGATTCCTGG + Intronic
1079116460 11:17643454-17643476 TCTCTAGGTTGGGGGTTCCGTGG + Exonic
1079475982 11:20830013-20830035 TCCCAAGGTGGGGGGATTACAGG - Intronic
1079624664 11:22601822-22601844 TCCCAAGGTTCTGGGATTACAGG - Intergenic
1079742259 11:24077371-24077393 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081316098 11:41632318-41632340 TCCCAAGGTTCTGGGATTACAGG - Intergenic
1081370538 11:42295580-42295602 TCCCAAGGTTGTGGGATTATAGG + Intergenic
1081891768 11:46548732-46548754 TCCCAAAGTTCGGGGATTACAGG - Intronic
1082820550 11:57542007-57542029 TCCCAAGGTTCTGGGATTGCAGG - Intergenic
1083223099 11:61266279-61266301 TCCCAAGGTTTGGGGATTACAGG - Intronic
1083330134 11:61893682-61893704 TCCCAAAGTGGTGGGATTCCAGG - Intergenic
1083684024 11:64365427-64365449 TCCCCAGGTGGGGGGCTGCCAGG - Exonic
1083709583 11:64539743-64539765 TCCCAAAGTGGGGGGATTACAGG + Intergenic
1084626324 11:70310640-70310662 TCCCAAGGTTCTGGGATTACAGG + Intronic
1084683069 11:70678390-70678412 TCCCAAGGTGCTGGGATTCCAGG + Intronic
1084836218 11:71803725-71803747 TCCCTAAGTGCTGGGATTCCAGG - Intergenic
1085412234 11:76298137-76298159 TCCCTGGGTCAGGGGATCCCAGG - Intergenic
1085948228 11:81297994-81298016 TCCCAAAGTTCTGGGATTCCAGG + Intergenic
1086413112 11:86561898-86561920 TTAATAGGTTGGGGGATTCCAGG - Intronic
1086459466 11:86991842-86991864 TCCCAAGGTTCAGGGATTACAGG + Intergenic
1087038104 11:93773895-93773917 TCCCTCGGTGGGGGGCTTCTGGG + Intronic
1087382453 11:97423989-97424011 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1088391683 11:109321483-109321505 TCCCTAGGTTCTGGGATTATAGG + Intergenic
1088609210 11:111561099-111561121 TCCCAAGGTTCTGGGATTACAGG - Intronic
1089274608 11:117326167-117326189 TCCCAAAGTTCTGGGATTCCAGG + Intronic
1089383565 11:118053045-118053067 TCCCTAAGTGCTGGGATTCCGGG - Intergenic
1089598047 11:119594535-119594557 TCTCTGGATTGGGGGATACCAGG + Intergenic
1089804215 11:121068623-121068645 TCCCTAAGTGGTGGGATTACAGG - Intronic
1089935707 11:122361884-122361906 TCCCAAGGTTCTGGGATTACAGG + Intergenic
1090286309 11:125502556-125502578 TCCCAAGGTTCAGGGATTACAGG - Intergenic
1090938790 11:131369513-131369535 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1092115602 12:6000547-6000569 TCCCAAAGTTCTGGGATTCCAGG - Intronic
1092324421 12:7514494-7514516 TCCCAAAGTTCGGGGATTACAGG + Intergenic
1092676061 12:10922026-10922048 TCCCAATGTTCGGGGATTACAGG + Intronic
1092795327 12:12105639-12105661 TCCCAAAGTTGGGGGATTACAGG - Intronic
1093161923 12:15757370-15757392 TCCCAAAGTTCTGGGATTCCAGG - Intronic
1093478228 12:19578466-19578488 TCCCAAAGTTTTGGGATTCCAGG + Intronic
1094285072 12:28783518-28783540 TCCCAAGGTGATGGGATTCCAGG - Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096288347 12:50319715-50319737 TCCCAAGGTTCTGGGATTACAGG + Intergenic
1096392072 12:51237523-51237545 TCCCAAGGTTCTGGGATTACAGG - Intergenic
1096714226 12:53481604-53481626 TCCCAAAGTTCTGGGATTCCAGG + Intronic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098024390 12:66187386-66187408 TCCCAAGGTTCTGGGATTACAGG - Intergenic
1098313860 12:69173941-69173963 TCCCCCAGTTGGGTGATTCCTGG + Intergenic
1098531824 12:71550389-71550411 TCCCTAAGTTCTGGGATTACAGG + Intronic
1098544144 12:71692934-71692956 TCCCTAAGTTTTGGGATTACAGG - Intronic
1101066155 12:101023410-101023432 TCCCAAAGTTCTGGGATTCCAGG - Intronic
1101410116 12:104460403-104460425 TCCCAAGGTGCTGGGATTCCAGG - Intronic
1102064288 12:109960363-109960385 TCCCAAGGTTCTGGGATTACAGG - Intronic
1102187671 12:110962265-110962287 TCCCAAGGTTCAGGGATTACCGG + Intergenic
1102693919 12:114783157-114783179 TCCCTCGGTTGGGGTCTTCTCGG - Intergenic
1102787583 12:115617162-115617184 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1103114201 12:118311200-118311222 TCCCAAGGTGGTGGGATTACAGG - Intronic
1103190197 12:118994531-118994553 TCCTTAGGTTGGAGGATTGGAGG - Intronic
1103199293 12:119073581-119073603 TCCCAAAGTTCTGGGATTCCAGG + Intronic
1103259183 12:119571304-119571326 TCCCAAGGTGGTGGGATTACAGG - Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1103380848 12:120493277-120493299 TCCCTAAGTTTTGGGATTACAGG - Intronic
1103879505 12:124155195-124155217 TCCCAAAGTTGTGGGATTACAGG - Intronic
1103955665 12:124575447-124575469 TCCCAAGGTGCTGGGATTCCAGG - Intergenic
1105627297 13:22125308-22125330 TCCCAAGGTTCTGGGATTACAGG + Intergenic
1105882960 13:24619702-24619724 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1106254529 13:28010746-28010768 TCCCAAGGTGGGGGGATTACAGG - Intronic
1107879203 13:44818174-44818196 TCCCTAGGTTGGAAGTTCCCTGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108806366 13:54161689-54161711 TCCCAAGGTTCTGGGATTACAGG - Intergenic
1109308539 13:60665376-60665398 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1109356306 13:61233261-61233283 TCCCTAGGGTGTAGGATTCTGGG - Intergenic
1110400339 13:75082364-75082386 TCCCTAAGTGCTGGGATTCCAGG + Intergenic
1110862033 13:80355235-80355257 TCCCAAAGTTTGGAGATTCCAGG - Intergenic
1110899253 13:80800099-80800121 TCCCAACGTTGTGGGATTACAGG - Intergenic
1111261989 13:85752660-85752682 TCCCAAGGTGGTGGGATTACAGG + Intergenic
1112429246 13:99335894-99335916 TCCCTAAGTGCTGGGATTCCAGG - Intronic
1112650348 13:101389821-101389843 TCCCAAGGTTCTGGGATTCCAGG - Intronic
1113983244 13:114294040-114294062 TCCCAAAGTTTGGGGATTACAGG + Intronic
1114467818 14:22936816-22936838 TCCCAAAGTGGGGGGATTACAGG + Intergenic
1114645848 14:24255624-24255646 TCCCAAGGGTGGGAGCTTCCTGG + Intronic
1116730337 14:48613008-48613030 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1117247071 14:53897089-53897111 ACCCTAGGTTACAGGATTCCTGG - Intergenic
1117600784 14:57372238-57372260 CCCCTGGGTTTGGGGATTCTGGG + Intergenic
1118215186 14:63802363-63802385 TCCCCAGGTTCTGGGATTACAGG + Intergenic
1118989420 14:70784482-70784504 TCCCAAAGTTGTGGGATTACAGG - Intronic
1119285643 14:73452099-73452121 TCCCAAAGTTCTGGGATTCCAGG - Intronic
1119487997 14:75004430-75004452 TCCCAAAGTTGTGGGATTACAGG - Intronic
1119687550 14:76644768-76644790 TCCCAAGGTTGGAGAATTCCAGG - Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120340016 14:83207852-83207874 TCCCTAAGTGGTGGGATTACAGG - Intergenic
1121198619 14:92097781-92097803 TCCCTAAGTTCTGGGATTACAGG + Intronic
1121600060 14:95196670-95196692 TTTCCAGGTTTGGGGATTCCTGG + Exonic
1122291828 14:100684951-100684973 TCCCAAAGTTCTGGGATTCCAGG - Intergenic
1122485606 14:102077563-102077585 GCCCTTGGTTGGGGTATTCCTGG + Intergenic
1124111348 15:26791914-26791936 TCCCGAAGTTGTGGGATTACAGG + Intronic
1124213385 15:27783175-27783197 GCCCTGGGTGGGGGGATTCTGGG + Intronic
1124422534 15:29535423-29535445 TCCCAAAGTTGTGGGATTACAGG - Intronic
1125139273 15:36385318-36385340 TCCCAAGGTGCGGGGATTACAGG - Intergenic
1125453648 15:39835275-39835297 TCCCAAGGTTCTGGGATTACAGG + Intronic
1126076604 15:44917232-44917254 TCCCAAGGTGCTGGGATTCCAGG - Intergenic
1126459034 15:48895822-48895844 TCCCTAAGTGGTGGGATTACAGG - Intronic
1126611060 15:50530046-50530068 TCCCAAAGTTGTGGGATTACAGG - Intronic
1127092035 15:55476910-55476932 TCCCAAAGTTCGGGGATTACAGG - Intronic
1127540522 15:59934152-59934174 TCCCTAGGTGGTAGGATTACAGG - Intergenic
1128638148 15:69316337-69316359 TCCCAAGGTTCTGGGATTACAGG + Intronic
1129018260 15:72488982-72489004 TCCCAAAGTTGTGGGATTGCAGG - Intronic
1129117615 15:73373948-73373970 GCCCTAGCTTGGGCGATACCTGG + Intergenic
1129124678 15:73428663-73428685 TCCCAAAGTTGAGGGATTACAGG + Intergenic
1129410332 15:75347501-75347523 CCCCGAGCTTGGGGGGTTCCAGG - Intronic
1129547884 15:76417759-76417781 TCCCAAAGTTGTGGGATTACAGG - Intronic
1130012814 15:80165268-80165290 TCCCAAAGTTGTGGGATTACAGG - Intronic
1130930786 15:88426031-88426053 TCCCTGGGTTTGGGGCTCCCAGG - Intergenic
1131278722 15:91003963-91003985 TCCCTAAGTTCTGGGATTACAGG - Intronic
1131370367 15:91876044-91876066 TCCCAAGGTTCTGGGATTACAGG - Intronic
1131532019 15:93201845-93201867 TCCCCAGGTTCTGGGATTACAGG + Intergenic
1132697371 16:1207940-1207962 TCCCTAGGTTGGGGGATTCCTGG + Intronic
1132878868 16:2152411-2152433 TCCCAAGGTGGTGGGATTACAGG - Intronic
1132879051 16:2153240-2153262 GCCCTGGGCTGGGGGAGTCCTGG - Intronic
1132908134 16:2294425-2294447 TCCCAAAGTTCTGGGATTCCAGG - Intronic
1132922755 16:2407438-2407460 TCCCAAAGTTCTGGGATTCCAGG + Intergenic
1132992071 16:2801095-2801117 TCCCAAAGTTCGGGGATTACAGG + Intergenic
1133208854 16:4251437-4251459 TCCCAAAGTTGTGGGATTGCAGG - Intergenic
1133278096 16:4650042-4650064 TCCCAAGGTTCTGGGATTACAGG - Intronic
1133292485 16:4731849-4731871 TGCCTTGATTTGGGGATTCCTGG - Intronic
1133319820 16:4906137-4906159 CCCCAGGGTTGGGGGATGCCTGG - Intronic
1133941159 16:10310207-10310229 TCCCAAAGTGGGGGGATTACAGG + Intergenic
1134003894 16:10804487-10804509 TCCCAAGGTGCTGGGATTCCAGG - Intronic
1134476691 16:14580226-14580248 TCCCAAAGTTGGGGGATTACAGG + Intronic
1134723443 16:16400495-16400517 TCCCAAGGTGCTGGGATTCCAGG + Intergenic
1134943985 16:18311375-18311397 TCCCAAGGTGCTGGGATTCCAGG - Intergenic
1135029742 16:19028910-19028932 TCCCAAGGTTCTGGGATTACAGG + Intronic
1135795330 16:25435772-25435794 TCCCAAGGTTCTGGGATTACAGG + Intergenic
1136177292 16:28526180-28526202 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1136187455 16:28596587-28596609 TCCCTAGGGTCTGGGATTACAGG - Intronic
1136354792 16:29737330-29737352 TCCCTAAGTGCTGGGATTCCAGG - Intergenic
1136378937 16:29882316-29882338 TCCCAAAGTGGGGGGATTACAGG - Intronic
1137044746 16:35644433-35644455 CCCCTAGGCTGGTGGATTTCAGG + Intergenic
1137685112 16:50381384-50381406 GGCCTAGGTTGGTGGATTACTGG + Intergenic
1137858968 16:51827024-51827046 TCCCAAAGTTCTGGGATTCCAGG + Intergenic
1139255048 16:65532754-65532776 TCACTGGGTAGGGGGATTACGGG - Intergenic
1139540779 16:67614436-67614458 TCCCTAGGTGCAGGGATTACAGG - Intronic
1139613807 16:68076996-68077018 TCCCAAAGTTGTGGGATTACAGG - Intronic
1139716349 16:68816485-68816507 TCCCTAAGTTTTGGGATTACAGG - Intronic
1139731146 16:68946450-68946472 TCCCAAAGTGGGGGGATTACAGG + Intronic
1140109854 16:71994738-71994760 TCCCTAAGTGCGGGGATTACAGG - Intronic
1140231437 16:73120530-73120552 TCCCAAAGTTCTGGGATTCCAGG + Intergenic
1141320166 16:83000835-83000857 TCCCAAGGTTCTGGGATTACCGG + Intronic
1142018178 16:87763342-87763364 TCCCAAAGTTCGGGGATTACAGG - Intronic
1142653913 17:1377170-1377192 TCCCTAGGTGGTGGGATTACAGG + Intronic
1143892217 17:10111274-10111296 TCCCAAAGTTGTGGGATTACAGG - Intronic
1144197752 17:12911711-12911733 TCTCTAGAATGGGGGACTCCCGG + Intronic
1144296710 17:13882570-13882592 TCCCTAGTTTGCTGTATTCCTGG - Intergenic
1144546472 17:16200867-16200889 TCCCCAGGTTGGAGGATTTTGGG - Intronic
1144567120 17:16368884-16368906 TCCCAAAGTGGGGGGATTTCAGG - Intergenic
1144591014 17:16523864-16523886 TCCCAAGGTTCTGGGATTACAGG - Intergenic
1144889311 17:18484885-18484907 TCCCCCGGTTGGAGGATTCAGGG - Intronic
1145142898 17:20459411-20459433 TCCCCCGGTTGGAGGATTCAGGG + Intronic
1145299904 17:21626448-21626470 TCCCCAGGTTGGAGGATTTTAGG + Intergenic
1145350378 17:22076817-22076839 TCCCCAGGTTGGAGGATTTTAGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1146103104 17:30004891-30004913 TCCCAAAGTTGTGGGATTACAGG + Intronic
1146306630 17:31734767-31734789 TCCCAAGGTTCTGGGATTACAGG + Intergenic
1146559309 17:33854567-33854589 TCCCTACTTTGAGGGAATCCTGG - Intronic
1146618488 17:34376236-34376258 TCCTTAGGTTGGGGGAGTCAGGG - Intergenic
1147277676 17:39332797-39332819 TCCCAAAGTGGTGGGATTCCAGG + Intronic
1147289215 17:39428224-39428246 TCCCAAAGTTGTGGGATTACAGG - Intronic
1148039306 17:44693791-44693813 TCCCTAAGTGCGGGGATTACAGG - Intergenic
1148158883 17:45438813-45438835 TCCCAAAGTTGTGGGATTACAGG + Intronic
1148614392 17:48988715-48988737 TCCCAAAGTGGGGGGATTACAGG + Intergenic
1148860656 17:50602767-50602789 GCCCAAGGGTGGGGGCTTCCTGG + Intronic
1149603205 17:57906710-57906732 TCCCAAGGTTCTGGGATTACAGG - Intronic
1149617173 17:58010427-58010449 TCCCAAAGTGGGGGGATTACAGG + Intergenic
1149816365 17:59728578-59728600 TCCCAAAGTGGTGGGATTCCAGG - Intronic
1150269400 17:63853361-63853383 TCCCAAGGTTCTGGGATTACAGG - Intergenic
1150279567 17:63921312-63921334 TCCCTAAGTGGTGGGATTACAGG - Intergenic
1150351287 17:64446837-64446859 TCCCGAAGTTGTGGGATTACAGG - Intergenic
1150421649 17:65042098-65042120 TCCCTAAGTGCGGGGATTACAGG - Intronic
1151628183 17:75290984-75291006 TCCCAAGGTTCTGGGATTACAGG + Intergenic
1151635544 17:75345300-75345322 TCCCAAAGTTGTGGGATTACAGG + Intronic
1151667441 17:75553347-75553369 TGCCTATTTTGGGGGATGCCTGG - Intronic
1152217356 17:79041517-79041539 TCCCGAGGTGCTGGGATTCCAGG - Intronic
1152387299 17:79982400-79982422 TCCCAAAGTAGGGGGATTACAGG + Intronic
1153060471 18:989940-989962 TCCCAAGGTTCTGGGATTACAGG + Intergenic
1153272413 18:3335760-3335782 TCCCAAGGTTCTGGGATTACAGG - Intergenic
1153617070 18:6945151-6945173 TCCCAAGGTTTTGGGATTACAGG + Intronic
1153753011 18:8253123-8253145 CCCCTAGGTGAGGGGATGCCAGG + Intronic
1153816087 18:8791344-8791366 TCCCTTTCTTTGGGGATTCCCGG - Intronic
1154064176 18:11091125-11091147 TCCCAAGGTTTTGGGATTACAGG - Intronic
1154137266 18:11790913-11790935 TCCCTAAGTTCTGGGATTACAGG + Intronic
1155543955 18:26895606-26895628 TCACTTGGTGGGGGGATTTCGGG + Intergenic
1156964326 18:43072242-43072264 TCCCAAGGTTCTGGGATTACAGG + Intronic
1157023512 18:43815396-43815418 TCCCAAAGTTTGGGGATTACAGG - Intergenic
1157834761 18:50890370-50890392 TCCCAAAGTGGTGGGATTCCAGG + Intronic
1158028299 18:52930221-52930243 TCCCAAGGTTCTGGGATTACAGG + Intronic
1159028929 18:63211314-63211336 TCCCAAGGTGCTGGGATTCCAGG + Intronic
1159688420 18:71454021-71454043 TCCTTATTTTGGGGTATTCCTGG + Intergenic
1160410897 18:78674811-78674833 TCCCAAGGTGGTGGGATTACAGG + Intergenic
1160510901 18:79452746-79452768 TCCCTGGTTTTGGGGGTTCCTGG + Intronic
1160949694 19:1659540-1659562 TCCCAAAGTTCTGGGATTCCAGG + Intergenic
1161064979 19:2233093-2233115 TCCCTTGGGTGGGGGCTCCCTGG + Intronic
1161316090 19:3618320-3618342 TCCCTAGGGTGGGGCCGTCCTGG - Intronic
1161452882 19:4356292-4356314 TCCCTAAGTGCTGGGATTCCAGG - Intronic
1161818601 19:6515675-6515697 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1161936865 19:7377523-7377545 TCCCAAGGTGCTGGGATTCCAGG - Intronic
1161969013 19:7565806-7565828 TCCCTAGGATCTGGGATTTCGGG - Intergenic
1162088916 19:8265225-8265247 TCCCAAAGTTTGGGGATTACAGG - Intronic
1162227317 19:9234158-9234180 TCCCAAGGTGGTGGGATTACAGG + Intergenic
1162307294 19:9882938-9882960 TCCCAAAGTGGGGGGATTACAGG - Intronic
1162402549 19:10454616-10454638 TCCCCAGGTTTGGGGAGTCATGG - Intronic
1162703164 19:12534553-12534575 TCCCAAAGTTGTGGGATTACAGG - Intronic
1163057783 19:14734253-14734275 TCCCTAAGTGCGGGGATTACAGG - Exonic
1163121100 19:15218411-15218433 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1163288744 19:16365008-16365030 GCCCTGGGTTTGGGGGTTCCTGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163706648 19:18818110-18818132 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1164035021 19:21445885-21445907 TCCCAAGGTTCTGGGATTACAGG + Intronic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164282548 19:23781595-23781617 TCCCAAGGTGGTGGGATTACAGG + Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164941668 19:32255903-32255925 TTCCTAGGTACTGGGATTCCAGG - Intergenic
1165357485 19:35312777-35312799 TCCCAAAGTTGTGGGATTACAGG - Intronic
1165620803 19:37245729-37245751 TCCCAAAGTTCGGGGATTACAGG + Exonic
1165829808 19:38724743-38724765 TCCCCAGGTGCCGGGATTCCAGG - Intronic
1165854610 19:38871841-38871863 TGCAGAGGTTGGAGGATTCCAGG + Exonic
1165945466 19:39439302-39439324 TCCCAAGGTTCTGGGATTACAGG + Intronic
1166561308 19:43734100-43734122 TTCCTGAGTTGGGAGATTCCAGG + Intronic
1166738032 19:45097561-45097583 GCCCAGGGTTTGGGGATTCCTGG + Intronic
1166848612 19:45746223-45746245 TCCCAAAGTTCGGGGATTACAGG + Intronic
1166849118 19:45749744-45749766 TCCCAAAGTTCTGGGATTCCAGG - Intronic
1167096743 19:47378569-47378591 TCCCAAGGTGCTGGGATTCCAGG - Intronic
1167251680 19:48401840-48401862 TCCCAAAGTGGTGGGATTCCAGG - Intronic
1167341657 19:48920025-48920047 TCCCTAAGTGGTGGGATTACAGG + Intronic
1167385860 19:49163018-49163040 TCCCTAAGTTCTGGGATTACAGG + Intronic
1167437813 19:49490060-49490082 TCCCCAGGGTTGGGGACTCCAGG + Intronic
1167440159 19:49503700-49503722 TCCCTAAGTAGTGGGATTACAGG - Intergenic
1167479161 19:49718823-49718845 TCCCTAGGTGCAGGGATTACAGG - Intergenic
1167855510 19:52235470-52235492 TCCCAAGGTGGTGGGATTACAGG - Intergenic
1167905824 19:52659932-52659954 TCCCAAGGTCGTGGGATTACAGG - Intronic
1167906633 19:52665900-52665922 TCCCAAAGTGGGGGGATTACAGG - Intronic
1168104425 19:54157966-54157988 TCCCAAGGTGGTGGGATTACAGG + Intronic
1168220259 19:54955408-54955430 GCCCAAAGTTCGGGGATTCCAGG - Intronic
1168379215 19:55906077-55906099 TCCCAAGGTGCTGGGATTCCAGG - Intronic
925026355 2:610261-610283 TCTCCAGGCTGGGGTATTCCTGG - Intergenic
925551653 2:5082417-5082439 TCCCAAGGTACGGGGATTACAGG + Intergenic
925596834 2:5563605-5563627 GCCCTGGGCTGGGGGATTCGTGG + Intergenic
926989355 2:18660880-18660902 TCCCAAAGTTGTGGGATTACAGG - Intergenic
927689690 2:25199447-25199469 TCCCTAAGTTCTGGGATTACAGG - Intergenic
927788526 2:25991426-25991448 TCCCTAAGTGGTGGGATTACAGG - Intergenic
928055695 2:28051906-28051928 TCCCAAGGTTCTGGGATTACAGG + Intronic
928552173 2:32383299-32383321 TCCCAAAGTGGTGGGATTCCAGG + Intronic
928579392 2:32691555-32691577 TCCCAAAGTGGGGGGATTACAGG + Intronic
928665354 2:33546066-33546088 TCCCAAAGTTCTGGGATTCCAGG + Intronic
929205672 2:39289824-39289846 TCCCAAAGTTGTGGGATTACAGG - Intronic
929690617 2:44069528-44069550 TCCCAAAGTTTGGGGATTACAGG + Intergenic
929823024 2:45288596-45288618 TCCCAAGGTTCTGGGATTACAGG + Intergenic
929931163 2:46256576-46256598 GCCCTAGGTTGGGGGAGGCAGGG - Intergenic
930227468 2:48808611-48808633 GCACTAGGTTGGAGGATTGCAGG - Intergenic
930653992 2:53990388-53990410 TCCCAAGGTGGTGGGATTACAGG - Intronic
930768105 2:55105486-55105508 TCCCAAAGTTGTGGGATTACAGG + Intronic
930991698 2:57663912-57663934 TCCCAAAGTTGTGGGATTACAGG - Intergenic
932072359 2:68634154-68634176 TCCCAAGGTTCTGGGATTACAGG + Intergenic
932696556 2:73961770-73961792 TCCCTAGGTGCTGGGATTACAGG - Intergenic
932724650 2:74168905-74168927 TCCCTCAGATAGGGGATTCCTGG - Intronic
933314909 2:80704293-80704315 TCCCAAAGTAGAGGGATTCCAGG - Intergenic
935485314 2:103646272-103646294 TCCCAAGGTTTTGGGATTCCAGG - Intergenic
936519743 2:113204247-113204269 TCCCTAGATGGTGGGAGTCCTGG - Intronic
936704381 2:115054652-115054674 TCCCTAAGTGGTGGGATTCTAGG - Intronic
936711009 2:115131254-115131276 TCCCAAAGTTCGGGGATTACAGG - Intronic
937194957 2:120145684-120145706 TCCCAAGGTGGTGGGATTACAGG - Intronic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
938290265 2:130145194-130145216 TCCCAAAGTTCGGGGATTACAGG - Intergenic
938485860 2:131707310-131707332 TCCCTAAGTGGTGGGATTACAGG + Intergenic
938662787 2:133504747-133504769 TCCCAGGGTTGGTGCATTCCTGG + Intronic
938824688 2:134993132-134993154 TCCCAAAGTTCTGGGATTCCAGG + Intronic
939343105 2:140926599-140926621 TCCCAAAGTTCTGGGATTCCAGG + Intronic
940927945 2:159388806-159388828 TCCCAAAGTTCTGGGATTCCAGG - Intronic
942147057 2:173037342-173037364 TCCCTAGGTGCTGGGATTACAGG + Intronic
943338301 2:186645707-186645729 TCCCAAAGTGGGGGGATTACAGG - Intronic
943583803 2:189714686-189714708 TCCCAAGGTTCTGGGATTACAGG - Intronic
944486177 2:200208127-200208149 TCGCTAGGTTTGGGGGTTACGGG - Intergenic
945253464 2:207784172-207784194 TCTCTAAGTTGGGGGATTACAGG - Intergenic
945583954 2:211633898-211633920 TCCCAAGGTGTGGGGATTACAGG - Intronic
946034977 2:216734580-216734602 TCCCAAGGTTCTGGGATTACAGG + Intergenic
946567954 2:220988381-220988403 TCCCTAAGTTCTGGGATTACAGG - Intergenic
947208409 2:227683436-227683458 TCCCAAAGTGGTGGGATTCCAGG + Intergenic
947423118 2:229958525-229958547 TCCCTAAGTGGTGGGATTACAGG + Intronic
947567942 2:231207264-231207286 TCCCAAAGTTGTGGGATTGCAGG + Intronic
947875772 2:233467439-233467461 GCCCTGAGTTGGGGGATTCGAGG + Intronic
948056055 2:235010066-235010088 TCAGTAGTTTGGGGGATCCCGGG - Intronic
948330404 2:237160245-237160267 TCCCAAGGTTCTGGGATTACAGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168792644 20:590188-590210 TCCCAAAGTTCTGGGATTCCAGG + Intergenic
1169055946 20:2621102-2621124 TCCCAAAGTTGTGGGATTACAGG - Intronic
1169183085 20:3588104-3588126 TCCCTAAGTTCTGGGATTACAGG + Intronic
1169321062 20:4633652-4633674 TCCTTAGGTTGGTGGATTTGAGG + Intergenic
1169428372 20:5513548-5513570 TCCCTAAGTGGTGGGATTACAGG + Intergenic
1170198285 20:13713661-13713683 TCCCAAAGTGGGGGGATTACAGG + Intergenic
1170670731 20:18430554-18430576 TCCCAAGGTTCTGGGATTACAGG - Intronic
1171476075 20:25410081-25410103 TCCCAAAGTGGGGGGATTACAGG - Intronic
1171560633 20:26121824-26121846 TCCCTAGGTTGGAGGATTTTAGG - Intergenic
1172289577 20:33766451-33766473 TCCCAAGGTTCTGGGATTACAGG + Intronic
1172327390 20:34047075-34047097 TCCCAAAGTGGGGGGATTACAGG + Intronic
1172476955 20:35246194-35246216 TCCCAAAGTTGTGGGATTACAGG - Intronic
1173856207 20:46252055-46252077 CACCTAGGGTGGGGGATTTCTGG - Intronic
1174015992 20:47488698-47488720 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1175218130 20:57402201-57402223 TCCCTAAGTGCTGGGATTCCAGG + Intronic
1176196252 20:63837426-63837448 TCCCCAAGTAGGGAGATTCCTGG - Intergenic
1176417024 21:6482145-6482167 TCCCAAAGTTCGGGGATTACAGG - Intergenic
1176650523 21:9542597-9542619 TCCCCAGGTTGGAGGATTTTAGG + Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1177398954 21:20577062-20577084 TCCCAAGGTTCTGGGATTGCAGG - Intergenic
1177644616 21:23885968-23885990 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1177653689 21:23988600-23988622 TCCCAAGGTTCTGGGATTACAGG + Intergenic
1178347730 21:31846073-31846095 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1178506317 21:33166096-33166118 TCCCAAAGTAGTGGGATTCCAGG + Intronic
1178948998 21:36970489-36970511 TCCCAAAGTTGTGGGATTACAGG + Intronic
1178977182 21:37230123-37230145 TCCCAAAGTGGTGGGATTCCAGG + Intronic
1179500986 21:41808467-41808489 TCCCTAGTTTGGGGGTGACCCGG - Intronic
1179692522 21:43090478-43090500 TCCCAAAGTTCGGGGATTACAGG - Intergenic
1179712632 21:43272159-43272181 TCCCTAAGTGCTGGGATTCCAGG - Intergenic
1181113779 22:20618367-20618389 TCCCTAAGTGCTGGGATTCCAGG + Intergenic
1181541853 22:23577789-23577811 TCCCAAAGTTGTGGGATTACAGG + Intronic
1182232333 22:28847958-28847980 TCCCAAGGTCGTGGGATTACAGG + Intergenic
1182703493 22:32260055-32260077 TCCCTGGGCTGGGGGACTCAGGG + Intergenic
1183612626 22:38920784-38920806 TCCCAAGGTAGTGGGATTACAGG - Intergenic
1184078350 22:42198921-42198943 TCCCAAGGTTCTGGGATTACAGG + Intronic
1184581112 22:45418395-45418417 TCCCTGGGCTTGGGGAGTCCTGG - Intronic
1184983085 22:48108673-48108695 TCTCTAGGTTGGGAGCTTTCTGG - Intergenic
949833700 3:8245046-8245068 TCCCTAGGTTGGGTATTTCTAGG - Intergenic
950084304 3:10246771-10246793 TCCCAAGGTGCGGGGATTACAGG + Intergenic
951047511 3:18056888-18056910 TCCCAAAGTTGTGGGATTACAGG + Intronic
951236602 3:20243397-20243419 TCCCTGGTTAGGGGTATTCCTGG - Intergenic
952179525 3:30902976-30902998 GAGCTAGGTTGGGGGATTGCTGG - Intergenic
952442056 3:33340766-33340788 TCCCTAGGATCTGGGATTACAGG - Intronic
953028623 3:39161174-39161196 TCCCTAAGTTCTGGGATTACAGG + Intergenic
953252324 3:41257371-41257393 TCCCTAAGTTTTGGGATTACAGG - Intronic
953475084 3:43198726-43198748 GCCCTAGATTGGAGGTTTCCTGG + Intergenic
953713406 3:45294606-45294628 TCCCCAGGTTCTGGGATTACAGG - Intergenic
954286655 3:49624257-49624279 TCCCAAAGTGCGGGGATTCCAGG + Intronic
954628538 3:52035947-52035969 ACCCTGGGCTGGGGGAGTCCCGG - Intergenic
954927134 3:54245947-54245969 TCCCTAGGTGATGGGATTACAGG + Intronic
955341251 3:58127062-58127084 TCCCAAAGTTTGGGGATTACAGG - Intronic
955737348 3:62053523-62053545 TCCCAAAGTTGTGGGATTACAGG + Intronic
955973619 3:64460463-64460485 TCCCTGAGATGGGGCATTCCAGG + Intergenic
958098555 3:88979051-88979073 TCCCAAGGTTTTGGGATTACAGG + Intergenic
961014139 3:123454476-123454498 TCCCAAGGTGCGGGGATTACAGG - Intergenic
961748603 3:129081963-129081985 TCCTCAGGTCTGGGGATTCCTGG - Intergenic
961885758 3:130095287-130095309 TCCCTAAGTGCTGGGATTCCAGG + Intronic
962015091 3:131431303-131431325 TCCTGGGGTTGGGGGATTCGGGG - Intergenic
963745903 3:149124999-149125021 TCCCAAGGTGCGGGGATTACAGG - Intergenic
964334848 3:155644342-155644364 TCCCTAAGTTCTGGGATTACAGG - Intronic
965370240 3:167853159-167853181 TCCCTAGGTGCTGGGATTACAGG - Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966189250 3:177256759-177256781 TCCCAAAGTTGTGGGATTACAGG + Intergenic
967569757 3:191015092-191015114 TCACTAGGTTGGGGAAGTTCTGG + Intergenic
968269955 3:197395815-197395837 TCCCCAGGTGCTGGGATTCCAGG - Intergenic
968842018 4:3014533-3014555 TCCCTAAGTGGTGGGATTACAGG - Intronic
968994951 4:3939430-3939452 TCCCTAAGTGCTGGGATTCCAGG + Intergenic
969182880 4:5455602-5455624 TCCCTGGGTTTGGGGTTTCCAGG - Intronic
969759045 4:9169363-9169385 TCCCTAAGTGCTGGGATTCCAGG - Intergenic
969819012 4:9706843-9706865 TCCCTAAGTGCTGGGATTCCAGG - Intergenic
970830921 4:20338828-20338850 TCCCAAAGTGGTGGGATTCCTGG - Intronic
971431035 4:26567699-26567721 TCCCAAAGTTCTGGGATTCCAGG + Intergenic
971878925 4:32342597-32342619 TCCCAAGGTAGTGGGATTACAGG - Intergenic
972478831 4:39478947-39478969 TCCCAAGGTGGTGGGATTACAGG - Intergenic
972508943 4:39749402-39749424 TCCCTAGGTGCTGGGATTACAGG - Intronic
972693877 4:41425603-41425625 TCCCTAAGTTCTGGGATTACAGG + Intronic
973022224 4:45218041-45218063 TCCCTAGGTACTGGGATTACAGG - Intergenic
973763735 4:54144705-54144727 TCCCAAGGTTCTGGGATTACAGG + Intronic
974263149 4:59551001-59551023 TCCCTAAGTTCTGGGATTACAGG - Intergenic
975819005 4:78250705-78250727 TCCCCTGGTTGAGTGATTCCAGG + Intronic
975830875 4:78367144-78367166 TCCCTAAGTGGTGGGATTACAGG - Intronic
977188154 4:93966389-93966411 TCCCAAGGTTCTGGGATTACAGG + Intergenic
977422565 4:96821399-96821421 TCCCAAGGTTCTGGGATTACAGG - Intergenic
977958015 4:103052803-103052825 TCCCAAGGTGGTGGGATTACAGG + Intronic
979046765 4:115876620-115876642 TCCCTAAGTTCTGGGATTACAGG - Intergenic
979564719 4:122141515-122141537 TCCCAAGGTTTGGGGATTACAGG + Intergenic
979566090 4:122155580-122155602 TCCCTAAGTGGTGGGATTACAGG + Intronic
980143347 4:128948794-128948816 GACTGAGGTTGGGGGATTCCAGG + Intronic
980344980 4:131602170-131602192 TCCCAAAGTTCGGGGATTACAGG - Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
981276240 4:142901006-142901028 TTCCCAGGTTGGAGGGTTCCTGG - Intergenic
981517440 4:145625074-145625096 TCCCCAGCTTATGGGATTCCTGG + Intronic
982038997 4:151376228-151376250 TCCCTAAGTGCTGGGATTCCAGG - Intergenic
982285855 4:153733700-153733722 TTAGGAGGTTGGGGGATTCCAGG - Intronic
984890820 4:184491092-184491114 TCCCAAAGTGCGGGGATTCCAGG + Intergenic
985324521 4:188753211-188753233 TCCCTAAGTGCTGGGATTCCAGG - Intergenic
986414285 5:7512501-7512523 TTCCTAGGTTTGGGGATTAGGGG + Intronic
986940429 5:12941983-12942005 TCCCAAGGTTCTGGGATTACAGG - Intergenic
988158642 5:27490214-27490236 TCCCAAAGTTGTGGGATTACAGG - Intergenic
988652301 5:33166299-33166321 TCCCTAGGGATGGGGCTTCCTGG + Intergenic
988789189 5:34591769-34591791 TCCCGAGGTTGTGAGCTTCCTGG + Intergenic
988877382 5:35462070-35462092 TCCCAAAGTTTGGGGATTACAGG - Intergenic
989045962 5:37273688-37273710 TCCCAAGGTTCTGGGATTACAGG + Intergenic
990454913 5:55975624-55975646 TCCCAAGGTTCTGGGATTACAGG + Intronic
990955674 5:61336002-61336024 TCCCAAAGTTCGGGGATTACAGG - Intronic
991042056 5:62186381-62186403 TCCCAAGGTGCTGGGATTCCAGG - Intergenic
991066385 5:62429171-62429193 TCCCTAGGCTGGGGAATTGGGGG - Intronic
991577018 5:68115224-68115246 TCCCTAAGTGGTGGGATTACAGG + Intergenic
991760073 5:69911298-69911320 TCCCAAGGTGTAGGGATTCCAGG + Intergenic
991839303 5:70786349-70786371 TCCCAAGGTGTAGGGATTCCAGG + Intergenic
991882145 5:71225221-71225243 TCCCAAGGTGTAGGGATTCCAGG - Intergenic
993644601 5:90446914-90446936 TCCCAAAGTTGTGGGATTACAGG + Intergenic
994740368 5:103610462-103610484 TCCCAAGGTGGTGGGATTACAGG - Intergenic
994954503 5:106510749-106510771 TCCCAAGGTGGGGGGATTACAGG - Intergenic
995108032 5:108397755-108397777 TCCCTAAGTTCTGGGATTACAGG + Intergenic
995141233 5:108737622-108737644 TCCCAAGGTGCTGGGATTCCAGG - Intergenic
995167275 5:109058996-109059018 TCCCTAAGTGGTGGGATTACAGG + Intronic
995818338 5:116197638-116197660 TCCCTACGTTCTGGGATTACAGG + Intronic
996047317 5:118887897-118887919 TCCCAAAGTTGTGGGATTACAGG + Intronic
996070429 5:119124823-119124845 TCCCAAGGTGGTGGGATTACAGG + Intronic
996554655 5:124765845-124765867 TCCCAAAGTTCTGGGATTCCAGG + Intergenic
996660458 5:125996696-125996718 TCCCAAAGTGGTGGGATTCCAGG - Intergenic
996722425 5:126642945-126642967 TCCCAAGGTTCTGGGATTACAGG + Intergenic
997507058 5:134425929-134425951 TCCCAAAGTTTGGGGATTACAGG + Intergenic
997642546 5:135458837-135458859 TCCCTAGGTTTTGGGGCTCCTGG + Intergenic
998398846 5:141837102-141837124 TGCCTTGGTCAGGGGATTCCAGG - Intergenic
999052528 5:148538648-148538670 TCCCTGGTTAGGTGGATTCCTGG - Intronic
1000099968 5:158006650-158006672 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1002459282 5:179364922-179364944 TCCCAAAGTTCTGGGATTCCAGG + Intergenic
1003067845 6:2918614-2918636 TCCCAAAGTTTGGGGATTACAGG - Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003917368 6:10799787-10799809 TCCCTAAGTTCTGGGATTACAGG - Intronic
1004723000 6:18284775-18284797 TCCCTAAGTGGCGGGATTACAGG - Intergenic
1005367685 6:25095696-25095718 ACCCTTGGTAGGGGGACTCCAGG - Intergenic
1005521850 6:26608546-26608568 TCCCAAAGTGGGGGGATTACAGG - Intergenic
1005667312 6:28071169-28071191 TCCCAAAGTGGTGGGATTCCAGG + Intergenic
1005808155 6:29494361-29494383 TCCCTAGGATGAGGGAGTCAGGG - Intergenic
1006758775 6:36441006-36441028 TCCCTAAGTTTGGGGATTACAGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1006975663 6:38098406-38098428 TCCCAAAGTTGTGGGATTACAGG + Intronic
1007553862 6:42750119-42750141 TCCCAAGGTTCTGGGATTACAGG + Intronic
1007797311 6:44360224-44360246 TCCCAAGGTTTTGGGATTACAGG + Intronic
1008943897 6:57076140-57076162 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1009276592 6:61689407-61689429 TCACAAGTTTGGGGGACTCCAGG - Intronic
1011327665 6:86168183-86168205 TCCCCAGGTTCTGGGATTACAGG - Intergenic
1012991866 6:105934426-105934448 TCCCAAGGTTCTGGGATTACAGG - Intergenic
1014008345 6:116447284-116447306 ACCTTAGGTTGGGGGATTGGGGG + Intergenic
1014549050 6:122767650-122767672 TCCCTAAGTGGGGGAATTACAGG - Intergenic
1014601334 6:123416959-123416981 TCCCAAAGTTGTGGGATTACAGG + Intronic
1015486899 6:133782003-133782025 TCCCAAAGTTCGGGGATTACAGG + Intergenic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1016496388 6:144667314-144667336 TCCCAAAGTTCTGGGATTCCAGG + Intronic
1016836880 6:148486377-148486399 TCCCAAGGTTCTGGGATTACAGG + Intronic
1019692239 7:2422501-2422523 TCCCAAGGTTCTGGGATTACAGG + Intronic
1019696045 7:2446690-2446712 TCCCTTGGTGGGGGGATTCCTGG - Intergenic
1019700666 7:2473611-2473633 TCCCAAGGTTCTGGGATTACAGG + Intergenic
1019745010 7:2694929-2694951 TCCCAAGGTGCTGGGATTCCAGG + Intronic
1020026107 7:4901180-4901202 TCCCAAGGTGGTGGGATTACAGG - Intergenic
1020049215 7:5070954-5070976 TCCCTAAGTTCTGGGATTACAGG + Intronic
1020447077 7:8280358-8280380 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1020669507 7:11089430-11089452 TCCCTAGGTGCTGGGATTACAGG - Intronic
1020738990 7:11989465-11989487 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1021079741 7:16349692-16349714 TCCTTAGGTTGTGTGATTTCTGG - Intronic
1021835016 7:24662508-24662530 TCCCAAGGTATGGGGATTACAGG - Intronic
1022304570 7:29134839-29134861 TCCCAAGGTTCTGGGATTACAGG - Intronic
1022639924 7:32172562-32172584 TCCCAAGGTGGTGGGATTACAGG - Intronic
1022731592 7:33031864-33031886 TCCCTAAGTGCTGGGATTCCAGG - Intronic
1024643070 7:51347535-51347557 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1025277201 7:57593562-57593584 TCCCCAGGTTGGAGGATTTTAGG + Intergenic
1025752715 7:64307305-64307327 TCCCTAGGTTGCAGGACTGCAGG - Intergenic
1026828676 7:73598859-73598881 TCCCAAGGTGGTGGGATTACAGG - Intronic
1027875414 7:83762138-83762160 TCCCAAGGTGGTGGGATTTCAGG + Intergenic
1028156345 7:87434198-87434220 TCCCAAAGTTGTGGGATTACAGG + Intronic
1029279187 7:99425681-99425703 TCCCAAGGTGCTGGGATTCCAGG - Intronic
1029491401 7:100872425-100872447 TCCCAAAGTCGGGGGATTGCAGG + Intronic
1030191838 7:106818142-106818164 TCCCAAGGTGGTGGGATTACAGG - Intergenic
1031942607 7:127805166-127805188 TGCCTGGGTTAGGGGAATCCTGG - Intronic
1032120948 7:129155987-129156009 TCCCAAAGTTCTGGGATTCCAGG + Intronic
1032391755 7:131559559-131559581 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1032715587 7:134506458-134506480 TCCCAAGGTTCTGGGATTACAGG - Intergenic
1032960293 7:137025888-137025910 TCCCTAAGTGGTGGGATTACAGG - Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1034157463 7:148967331-148967353 TCCCTAGTGTGTGGGATTACAGG + Intergenic
1035694916 8:1588641-1588663 TCCCAAAGTTGTGGGATTACAGG - Intronic
1036508887 8:9382250-9382272 TCCCTAAGTTTTGGGATTACAGG + Intergenic
1036847464 8:12179598-12179620 TCCCTAAGTGCTGGGATTCCAGG + Intergenic
1036868832 8:12421919-12421941 TCCCTAAGTGCTGGGATTCCAGG + Intergenic
1037436706 8:18870839-18870861 TCCCTAAGTGGTGGGATTACAGG - Intronic
1038967862 8:32595445-32595467 TCCGTAAGTTGGGGGATTACAGG + Intronic
1039526247 8:38218786-38218808 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1039634279 8:39145988-39146010 TCCCTAAGTTTTGGGATTACAGG + Intronic
1040590729 8:48789903-48789925 GTCCAGGGTTGGGGGATTCCCGG + Intergenic
1041038487 8:53820721-53820743 TCCCAAAGTTGTGGGATTACAGG - Intronic
1042272261 8:66966525-66966547 TCCCAAAGTGGGGGGATTACAGG - Intronic
1042603131 8:70519164-70519186 TCCCAAGGTTCTGGGATTACAGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043172357 8:76981210-76981232 TCCCAAAGTTGTGGGATTACAGG - Exonic
1043654345 8:82643125-82643147 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1043742867 8:83836220-83836242 TCCCAAGGTTCTGGGATTACAGG - Intergenic
1043941769 8:86204443-86204465 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1044239417 8:89871054-89871076 TCCCAAGGTTCTGGGATTACAGG + Intergenic
1044986404 8:97760036-97760058 TCCCAAAGTTCGGGGATTACAGG - Intergenic
1045299383 8:100898094-100898116 TCCCAAGGTGGTGGGATTACAGG + Intergenic
1045347587 8:101307844-101307866 TCCCAAGGTTTTGGGATTACAGG + Intergenic
1046905119 8:119564417-119564439 TCCCAAAGTTCTGGGATTCCAGG - Intronic
1046961766 8:120120871-120120893 TCCCTAGTATTGGGGATTACAGG + Intronic
1047274983 8:123399002-123399024 TCCCAAAGTGGGGGGATTACAGG - Intronic
1047380975 8:124362401-124362423 TCCCAAAGTTGTGGGATTACAGG - Intronic
1047599820 8:126414819-126414841 TCCCTAAGTGCTGGGATTCCTGG + Intergenic
1047644940 8:126860636-126860658 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1049643357 8:143725335-143725357 TCCCAAAGTGGGGGGATTACAGG - Exonic
1049985058 9:942529-942551 TCCCAAGGTTTTGGGATTACAGG + Intronic
1050588546 9:7139011-7139033 TCCCAAGGTGCTGGGATTCCAGG - Intergenic
1051211243 9:14746920-14746942 TACCTTGGTTTGGGGACTCCAGG + Exonic
1051421283 9:16891626-16891648 TCCCTAAGTGCTGGGATTCCAGG + Intergenic
1051985170 9:23076543-23076565 TCCCTAGTAGGGGGGATTACAGG + Intergenic
1052420092 9:28232929-28232951 TCCCCAGGTTGGATGATACCAGG - Intronic
1053360422 9:37482733-37482755 TCCCTAGGTGTTGGGATTACAGG - Intergenic
1053414928 9:37941500-37941522 TCCCTCTGTTGGGGGAGTCATGG + Intronic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1057574419 9:96230614-96230636 TCCCTAGGTGCTGGGATTACAGG - Intergenic
1058544350 9:106044090-106044112 TCCATTGGTTTGGGGGTTCCTGG - Intergenic
1059168462 9:112101101-112101123 TCCCTAGGTGCTGGGATTACAGG - Intronic
1059369033 9:113810149-113810171 TCCCAAGGTGGTGGGATTACAGG + Intergenic
1059606166 9:115838771-115838793 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1060248618 9:121967479-121967501 TCCCAAGGTTCTGGGATTACAGG + Intronic
1060322465 9:122576491-122576513 TCCCAAGGTTCTGGGATTACAGG + Intergenic
1060538080 9:124407886-124407908 TCCCTAGGTTTTGGGATTACAGG - Intronic
1060633097 9:125177436-125177458 TCCCTAAGTGGTGGGATTACAGG - Intronic
1061161389 9:128896980-128897002 TCCCTAAGTTCTGGGATTACAGG + Intronic
1061770937 9:132920833-132920855 TCCCTTGATTGAAGGATTCCAGG - Intronic
1062039624 9:134398236-134398258 TCCCAAAGTTGTGGGATTACAGG + Intronic
1062204647 9:135329334-135329356 TCCCTGGGCTTGGGCATTCCTGG - Intergenic
1203628263 Un_KI270750v1:46151-46173 TCCCCAGGTTGGAGGATTTTAGG + Intergenic
1185599192 X:1327389-1327411 TCCCTAAGTGGTGGGATTACAGG - Intergenic
1185716822 X:2349421-2349443 TCCCAAGGTGCTGGGATTCCAGG - Intronic
1185831195 X:3304560-3304582 TCCCAAGGTTCTGGGATTACAGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186314493 X:8354452-8354474 TCCCAAAGTTCTGGGATTCCAGG + Intergenic
1186477478 X:9868836-9868858 TCCCAAAGTGGTGGGATTCCAGG + Intronic
1187879500 X:23833431-23833453 TCTCTAGGTGAAGGGATTCCAGG + Exonic
1187914933 X:24144532-24144554 TCCCAAAGTGGGGGGATTACAGG - Intergenic
1189765327 X:44366442-44366464 TCCCTAAGTTCTGGGATTACAGG - Intergenic
1190100861 X:47522042-47522064 TCCCAAGGTGTGGGGATTACAGG + Intergenic
1190198283 X:48338768-48338790 TCCCAAGGTGCTGGGATTCCAGG - Intergenic
1190369340 X:49726626-49726648 CCCCTAGGGTGGTGGGTTCCAGG - Intergenic
1190411123 X:50138306-50138328 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1190641917 X:52488260-52488282 TCCCTAGGCTGGAGGAGGCCCGG + Intergenic
1190645755 X:52524606-52524628 TCCCTAGGCTGGAGGAGGCCCGG - Intergenic
1190665046 X:52689230-52689252 TCCCAAGGTGCTGGGATTCCAGG - Intronic
1190674376 X:52769189-52769211 TCCCAAGGTGCTGGGATTCCAGG + Intronic
1190763248 X:53454085-53454107 TCCCAAGGTTCTGGGATTACAGG + Intergenic
1190885479 X:54527855-54527877 TCCCAAGGTGCTGGGATTCCAGG - Intergenic
1190904477 X:54712059-54712081 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1191782618 X:64885162-64885184 TCCCTAGGTGCTGGGATTGCAGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194250376 X:91567478-91567500 TCCCTAGGTGCTGGGATTACAGG - Intergenic
1194412805 X:93577919-93577941 CCCCCAGGGTGGGGGACTCCAGG - Intergenic
1195053539 X:101121132-101121154 TCCCAAGGTTCTGGGATTACAGG + Intronic
1195930875 X:110074134-110074156 TCCCAAAGTGGGGGGATTACAGG + Intronic
1196668899 X:118345659-118345681 GCCCTAGGGTGGGACATTCCGGG + Intergenic
1196734259 X:118970994-118971016 TCCCTAGGTGCTGGGATTACAGG + Intergenic
1197716641 X:129713058-129713080 TCCCAAGGTTCTGGGATTACAGG - Intergenic
1198197667 X:134381113-134381135 TCCCAAAGTGCGGGGATTCCAGG + Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200548593 Y:4550271-4550293 TCCCTAAGTGGTGGGATTACAGG + Intergenic
1200569332 Y:4808723-4808745 TCCCTAGGTGCTGGGATTACAGG - Intergenic
1200947030 Y:8852765-8852787 TCCCAAAGTAGGGGGATTACAGG + Intergenic
1201273162 Y:12275448-12275470 TCCCAAAGTGGTGGGATTCCAGG - Intergenic
1201972067 Y:19809221-19809243 TCCCAAGGTTCTGGGATTACAGG - Intergenic