ID: 1132700251

View in Genome Browser
Species Human (GRCh38)
Location 16:1219190-1219212
Sequence CTGGTCCTTCAGATGAGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 180}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132700251_1132700258 3 Left 1132700251 16:1219190-1219212 CCTCGTCTCATCTGAAGGACCAG 0: 1
1: 0
2: 1
3: 19
4: 180
Right 1132700258 16:1219216-1219238 ACGAGGACAAGGCAGGAGGAGGG 0: 1
1: 0
2: 32
3: 435
4: 2652
1132700251_1132700260 13 Left 1132700251 16:1219190-1219212 CCTCGTCTCATCTGAAGGACCAG 0: 1
1: 0
2: 1
3: 19
4: 180
Right 1132700260 16:1219226-1219248 GGCAGGAGGAGGGTCGCACTGGG 0: 1
1: 0
2: 0
3: 19
4: 251
1132700251_1132700263 22 Left 1132700251 16:1219190-1219212 CCTCGTCTCATCTGAAGGACCAG 0: 1
1: 0
2: 1
3: 19
4: 180
Right 1132700263 16:1219235-1219257 AGGGTCGCACTGGGTCCTTGGGG 0: 1
1: 0
2: 1
3: 8
4: 131
1132700251_1132700257 2 Left 1132700251 16:1219190-1219212 CCTCGTCTCATCTGAAGGACCAG 0: 1
1: 0
2: 1
3: 19
4: 180
Right 1132700257 16:1219215-1219237 GACGAGGACAAGGCAGGAGGAGG 0: 1
1: 0
2: 2
3: 68
4: 789
1132700251_1132700256 -1 Left 1132700251 16:1219190-1219212 CCTCGTCTCATCTGAAGGACCAG 0: 1
1: 0
2: 1
3: 19
4: 180
Right 1132700256 16:1219212-1219234 GCAGACGAGGACAAGGCAGGAGG 0: 1
1: 0
2: 2
3: 29
4: 387
1132700251_1132700262 21 Left 1132700251 16:1219190-1219212 CCTCGTCTCATCTGAAGGACCAG 0: 1
1: 0
2: 1
3: 19
4: 180
Right 1132700262 16:1219234-1219256 GAGGGTCGCACTGGGTCCTTGGG 0: 1
1: 0
2: 1
3: 5
4: 89
1132700251_1132700253 -8 Left 1132700251 16:1219190-1219212 CCTCGTCTCATCTGAAGGACCAG 0: 1
1: 0
2: 1
3: 19
4: 180
Right 1132700253 16:1219205-1219227 AGGACCAGCAGACGAGGACAAGG 0: 1
1: 0
2: 1
3: 18
4: 213
1132700251_1132700259 12 Left 1132700251 16:1219190-1219212 CCTCGTCTCATCTGAAGGACCAG 0: 1
1: 0
2: 1
3: 19
4: 180
Right 1132700259 16:1219225-1219247 AGGCAGGAGGAGGGTCGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 302
1132700251_1132700261 20 Left 1132700251 16:1219190-1219212 CCTCGTCTCATCTGAAGGACCAG 0: 1
1: 0
2: 1
3: 19
4: 180
Right 1132700261 16:1219233-1219255 GGAGGGTCGCACTGGGTCCTTGG 0: 1
1: 0
2: 1
3: 20
4: 145
1132700251_1132700255 -4 Left 1132700251 16:1219190-1219212 CCTCGTCTCATCTGAAGGACCAG 0: 1
1: 0
2: 1
3: 19
4: 180
Right 1132700255 16:1219209-1219231 CCAGCAGACGAGGACAAGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132700251 Original CRISPR CTGGTCCTTCAGATGAGACG AGG (reversed) Intronic
900175710 1:1290544-1290566 CAGGCCCTGCAGGTGAGACGGGG + Exonic
902233944 1:15045888-15045910 CTGGTCCTTCCCTTGACACGTGG + Intronic
902673307 1:17990998-17991020 CCGGTCCTTGACATGTGACGTGG + Intergenic
902814688 1:18909500-18909522 CTGGTCCCTCTCATGACACGTGG - Intronic
903944789 1:26955346-26955368 CTGGTCCTTCAAATCAGATATGG + Intronic
904276656 1:29389390-29389412 ATAGTCATTCAGAGGAGACGGGG - Intergenic
908592994 1:65653068-65653090 GTGGTCCTTTAGAGGAGAAGAGG - Intergenic
913011611 1:114688988-114689010 ATGGTCCTAAAGATGAGACCGGG + Intronic
915758046 1:158282230-158282252 GTGTTCCTTCAGAGGAGAAGAGG + Intergenic
916073469 1:161186065-161186087 CTGGTCCTGGAGATGAAAAGAGG - Exonic
916533039 1:165676673-165676695 CTGGTGCTTCAGCTGAAACCAGG - Intronic
916727084 1:167533095-167533117 CTGGTCCTTCAGATGCCCCAGGG - Intronic
920741529 1:208585696-208585718 CAGGTCCTTCCCATGACACGTGG - Intergenic
920850300 1:209623829-209623851 CTGATCCTTCAGGTGAGGAGAGG - Exonic
921918066 1:220635461-220635483 CTGGACCTTCAGGTGAGCAGGGG - Exonic
921942213 1:220853880-220853902 CTGGTTCTTCCTATGAGATGAGG + Intergenic
922676056 1:227550793-227550815 TTGATCCTTCGGATGAGAAGGGG - Intergenic
1066818383 10:39451534-39451556 CTGGTCCTTTAGAGGAGGAGAGG + Intergenic
1067548327 10:47213539-47213561 CGGGTCCCTCACATGAAACGTGG - Intergenic
1070519318 10:77238094-77238116 CTGGGAATTCAGATGAGATGAGG + Intronic
1070799921 10:79239339-79239361 CTGGTCCTTCTCAGGACACGTGG - Intronic
1073420217 10:103418522-103418544 GTGGTCCGACAGATGAGATGTGG - Exonic
1075371540 10:121940072-121940094 CTGGTCCCTCCCATGACACGTGG - Intergenic
1075568070 10:123519044-123519066 CAGGTCCTTCAGATAGGAAGGGG - Intergenic
1078328186 11:10397430-10397452 CTGGTCCCTCTCATGACACGGGG + Intronic
1078765547 11:14293509-14293531 CTGGTCCCTCCCATGACACGTGG - Intronic
1080791652 11:35526814-35526836 CTGGTCCCTCCCATGACACGTGG - Intronic
1080791798 11:35527954-35527976 CTGGTCCTTCCCATGACACGTGG + Intronic
1081414132 11:42793104-42793126 CTGGTCCTTCCTATGATACATGG - Intergenic
1081554264 11:44143497-44143519 GTCGTCCTTCAGATGAGAAGGGG + Intronic
1082006111 11:47420016-47420038 CTGTGCCTTCAGATGAGGGGTGG + Intronic
1082906516 11:58313015-58313037 CTGGTCCCTCCCATGACACGTGG + Intergenic
1082921719 11:58502714-58502736 TTGGTCATTCAGATTAGAAGAGG - Intergenic
1085332741 11:75667454-75667476 CAGCTCCTACAGGTGAGACGCGG - Exonic
1090643643 11:128749907-128749929 TTGGCACTTCAGATGAGACTTGG + Intronic
1092048910 12:5454151-5454173 CTGGGCCTTCAGATGAAACACGG - Intronic
1092597823 12:10026793-10026815 CAGGTCCTTCCCATGACACGTGG - Intergenic
1093783121 12:23160052-23160074 CAGGTCCTTCCCATGACACGTGG - Intergenic
1097813847 12:64049563-64049585 CTGGTCCTTCACATGACATGTGG + Intronic
1098183058 12:67868922-67868944 GTGATCCTTCAGAAGAGAAGAGG + Intergenic
1098688395 12:73455245-73455267 CTGGTCCCTCCCATGACACGTGG - Intergenic
1098766149 12:74491810-74491832 ATGCTCCCTCAGATGAGAAGGGG + Intergenic
1103323242 12:120103639-120103661 CTGGTCCTGAAGATGTGAGGGGG - Intronic
1104416441 12:128599860-128599882 CAGGTCCTTCCTATGACACGTGG - Intronic
1105472238 13:20704280-20704302 CTGGGCCTACAGGTGAGCCGCGG + Exonic
1110882504 13:80589427-80589449 CTGGTCCTTCCCATGACACATGG + Intergenic
1111098937 13:83554930-83554952 ATGGTTCTTCAGACGAGACTAGG - Intergenic
1112946905 13:104939706-104939728 CTGGTCCCTCCCATGACACGTGG - Intergenic
1113329713 13:109316544-109316566 CTGGTCCTTCCCATGACATGTGG + Intergenic
1113708218 13:112447507-112447529 CTGAGCCTTCTGATGAGACCTGG + Intergenic
1115846358 14:37539882-37539904 CTGGTCCCTCCGATGAGACATGG - Intronic
1116784316 14:49270306-49270328 CTGGTCCCTCCCATGACACGTGG - Intergenic
1119173812 14:72554722-72554744 TTGTTCCGTCAGATGAGAGGAGG + Intronic
1119817048 14:77578944-77578966 CTGGTCCTTCAAGTGAGTCTTGG - Exonic
1120285780 14:82499255-82499277 CTGGTCCCTCCCATGACACGTGG - Intergenic
1120342705 14:83242627-83242649 CTGGTCCTGAATAAGAGACGAGG + Intergenic
1121689202 14:95863754-95863776 CTGAGCCTTGAGATGAGACAGGG + Intergenic
1122787993 14:104172764-104172786 CTGGTCCTACACATGGGCCGTGG + Intronic
1128324447 15:66714921-66714943 TTGCTACTTCAGATGAGAAGTGG + Intronic
1129166909 15:73783718-73783740 CTGGTCCTTCCCATGACACATGG - Intergenic
1130458316 15:84137622-84137644 CTGTTCCTTAAGATGAGTAGTGG + Intergenic
1132700251 16:1219190-1219212 CTGGTCCTTCAGATGAGACGAGG - Intronic
1132841939 16:1982351-1982373 CTGGGCCCTCAGCTGAGACAGGG - Exonic
1133089816 16:3395361-3395383 CGGGTCCTTCCCATGACACGTGG - Intronic
1134812224 16:17177353-17177375 CTGGTCCTTTAGAAGAGAAGGGG + Intronic
1137776020 16:51054947-51054969 CTGGTCCCTCCGATGACACATGG + Intergenic
1138392893 16:56683062-56683084 CTGGTCCTTCAGCACAGAGGAGG + Intronic
1139128664 16:64113622-64113644 CTGGTCCCTCACTTGACACGTGG + Intergenic
1139392672 16:66614900-66614922 CTGGTCCTTCAAATGAAAGGGGG + Exonic
1141043475 16:80692392-80692414 GTGGTCCTTCAGATGAGAACGGG + Intronic
1142246081 16:88970680-88970702 CTGGTCCTTCAGTTGTTACTTGG - Intronic
1150353780 17:64466235-64466257 CTGGTCCCTCCCATGAGATGTGG + Intronic
1152686758 17:81697553-81697575 CTGGCCGTTCGGCTGAGACGGGG + Intronic
1155413395 18:25570809-25570831 CTGGTCCTTCCCATGACATGTGG + Intergenic
1155546275 18:26919147-26919169 CTGGTCCCTCCCATGACACGTGG + Intronic
1158684562 18:59601286-59601308 CTGGTCCCTCCCATGACACGTGG - Intronic
1159288965 18:66391538-66391560 CAGGTCCTTCTGTTGAGACATGG - Intergenic
1160268256 18:77359630-77359652 CTGGTCCCTCCCATGACACGTGG - Intergenic
1160340103 18:78082453-78082475 GTGGTCCTTCAGAGGAAAGGAGG + Intergenic
1162726789 19:12694788-12694810 CTGCTGCTCCAGGTGAGACGGGG - Exonic
1162913519 19:13862471-13862493 CCGGTCCTGGAGAAGAGACGGGG + Intronic
1165344683 19:35237296-35237318 CGGGTCCTTCCCATGACACGTGG - Intergenic
1166255620 19:41602100-41602122 CTCGTCCTTCACATGAGACTTGG + Intronic
1166264787 19:41672825-41672847 CTTGTGCTGCAGATGAGAAGAGG + Intronic
1166273352 19:41732824-41732846 CTTGTGCTTCAGATGAGAAGAGG - Intronic
1166444091 19:42843932-42843954 CTGTTCCCCCAAATGAGACGGGG - Intronic
1167837909 19:52089791-52089813 GTGGGCCTTCAGATGAGCCATGG - Intronic
1168284205 19:55322379-55322401 CTGGTTCTTCAGGTGTGAAGGGG - Intronic
925212519 2:2062050-2062072 CTGTTCCCCTAGATGAGACGTGG - Intronic
925444978 2:3919844-3919866 CTGGTTCTGCAGGTGAGAGGTGG + Intergenic
927237209 2:20885201-20885223 CAGGTCCTTCCCATGACACGTGG - Intergenic
927461048 2:23298415-23298437 CTGGTCCTTGAGCAGAGAAGAGG - Intergenic
929799680 2:45088907-45088929 ATGGTCCTTCATGTGAGACAGGG + Intergenic
930986789 2:57598804-57598826 CTGGCCTTTCAGAGGAGACGGGG + Intergenic
931555335 2:63497257-63497279 CTGTTTCTTCAGATGATACAGGG - Intronic
931949707 2:67349341-67349363 CTGGTCCTTCCCATGACATGTGG + Intergenic
932370139 2:71180076-71180098 CTGTTCTTTCAGAAGAGACCTGG - Intergenic
934515380 2:94982860-94982882 CTGTTCCTCCAGATGAGACAGGG + Intergenic
937923490 2:127149114-127149136 ATTGTCTTTCAGATGAGATGGGG + Intergenic
939095341 2:137827443-137827465 CTGGTCCTTCAAATAAGAGTTGG + Intergenic
939436392 2:142182942-142182964 CTGGTCCCTCCGATGACATGTGG - Intergenic
941077553 2:161023007-161023029 CTGGTCCTTCCCATGACACATGG + Intergenic
945031231 2:205665530-205665552 CTGATCCATCAGAGGAGACTGGG - Intergenic
946596459 2:221310792-221310814 CTGGTCCTTCCCATGACACGTGG + Intergenic
946660286 2:221992252-221992274 CTGGTGCTGGAGATGAGAGGAGG - Intergenic
948865986 2:240775077-240775099 GTGTTCCTTCACCTGAGACGTGG - Intronic
1170000472 20:11608525-11608547 CTGGGCCTTCAGCAGACACGAGG + Intergenic
1171045861 20:21809125-21809147 CAGGACCTGCAGATGAGAAGTGG + Intergenic
1172725707 20:37039410-37039432 CTGGTCCCTCCCATGACACGTGG - Intronic
1173087185 20:39934296-39934318 CTGGTCCCTCCCATGACACGTGG + Intergenic
1174918484 20:54677567-54677589 CTGGTCTTCCAGGTGAGATGTGG + Intergenic
1176180058 20:63745598-63745620 CTGTGCCTTCAGATGGGAGGTGG - Exonic
1177854069 21:26382362-26382384 CTGGTCCCTCCCATGACACGTGG - Intergenic
1178156334 21:29858359-29858381 CTGGTACTGCAGAAGAGATGAGG - Intronic
1178543633 21:33475940-33475962 GAGGTCCTTCAGATTAGAGGGGG - Intronic
1179096013 21:38314812-38314834 CTGGTTCTTCTGATAAGACCGGG + Intergenic
1179267499 21:39817216-39817238 CAGGTCCTTCCCATGACACGTGG - Intergenic
1181036013 22:20169975-20169997 CTGGTCCACCAGATGAGGCGTGG - Intergenic
1181058891 22:20272644-20272666 CTGGACCTTGAGATGAGCCTCGG + Intronic
1181534779 22:23535715-23535737 CAGGTCCTGCGGAGGAGACGCGG - Intergenic
1182811648 22:33121980-33122002 CAGGTCCTTCCCATGACACGTGG + Intergenic
1183094544 22:35544269-35544291 CTGGGCCTTCAGCAGAGATGGGG - Intronic
951163806 3:19460750-19460772 CTGGTCCTTCCCATGATATGTGG - Intronic
951462705 3:22968585-22968607 CTGGTGGTCCAGATGAGACCAGG + Intergenic
953538803 3:43796285-43796307 CTGGTCCTACAGCTGAGCCCTGG + Intergenic
955842889 3:63130727-63130749 CTAATCCTTCAGATTAGAAGTGG - Intergenic
956698468 3:71938333-71938355 CTGGTCCCTCCCATGACACGTGG + Intergenic
957765619 3:84621049-84621071 CTGGTCCCTCCCATGACACGTGG + Intergenic
958090330 3:88869384-88869406 CTGGTCCTTCCCATGACATGGGG + Intergenic
958616570 3:96500565-96500587 CTGTTTCTTCAGATGATACGTGG - Intergenic
958836358 3:99149094-99149116 CTGGTCCTTCCCATGATATGTGG - Intergenic
963150534 3:142041359-142041381 CTGGTCCTTCCCATGACACATGG - Intronic
963265456 3:143235643-143235665 CTTGTGCTTCAGAGGAGACTTGG - Intergenic
964271679 3:154963317-154963339 CTGGTCCTTCTGATGAGGACTGG - Intergenic
964531114 3:157668900-157668922 TTGCTCCTTCAGCTGAGGCGTGG + Intronic
966335998 3:178869052-178869074 CTGATGCTTCAAATGAGACTAGG - Intergenic
966493849 3:180557388-180557410 GTGATCCTTCAGAGGAGAAGAGG - Intergenic
967586771 3:191222765-191222787 CTGGTCCTTCCCATAACACGAGG - Intronic
970488631 4:16549187-16549209 CTGGGCATTCAGATGAAACCAGG - Intronic
971042788 4:22773123-22773145 CAGGTCCTTCCCATGACACGTGG + Intergenic
973264519 4:48198140-48198162 CTGGTTCTTCAGATGAAAAGTGG - Intronic
974887558 4:67839116-67839138 CTGGTCATTGAGGTGAGAGGAGG - Intronic
976050590 4:81008094-81008116 CTGGTCCTTCCCATGACATGTGG - Intergenic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
981301185 4:143186964-143186986 CTGGTTCTTAAGATAAGAAGAGG - Intronic
983409551 4:167379464-167379486 CTGGTCCTACAGATTAGGCTAGG - Intergenic
985401878 4:189601064-189601086 CTGGTGTTGCAGAGGAGACGTGG - Intergenic
986967031 5:13286405-13286427 CAGGTCCTTCCCATGACACGTGG - Intergenic
987940672 5:24531699-24531721 CTGGTCCCTCCCATGACACGTGG + Intronic
989646438 5:43637989-43638011 CTGGTCCTTCCCGTGATACGTGG - Intronic
993517393 5:88855577-88855599 CTGGTCCCTCCCATGACACGTGG - Intronic
993806799 5:92420473-92420495 CAGGTGCTACAGATGAGATGGGG + Intergenic
995553110 5:113299928-113299950 CTGGTCCCTGGGATGAGAAGAGG + Intronic
1000246136 5:159449946-159449968 CTGGGCCTTCATATGAGCGGAGG - Intergenic
1001071486 5:168588872-168588894 CAGGTCCTTCAGATGCAACCTGG + Intergenic
1002021496 5:176366606-176366628 CTGGTCCAGTAGAGGAGACGGGG - Intronic
1002384932 5:178859787-178859809 CTGGTTCTTCGGAAGAGAAGGGG - Intergenic
1003679721 6:8240554-8240576 CTGGCATTTCTGATGAGACGAGG + Intergenic
1004813707 6:19288906-19288928 CTGGTCCCTCACAAGACACGTGG + Intergenic
1005219515 6:23570898-23570920 CAGGTCCTTAAGAAGAGATGTGG - Intergenic
1006059642 6:31410768-31410790 CTGGTCCTTGATATGAGCCAGGG - Exonic
1006072129 6:31505842-31505864 CTGGTCCTTGATATGAGTCAGGG - Exonic
1010093703 6:72014303-72014325 CTGGTCCCTCCTATGACACGTGG + Intronic
1011457850 6:87571122-87571144 CTGGTCCCTCCCATGACACGTGG - Intronic
1011492982 6:87911695-87911717 CTGGTCCATGAGCTGAGACTGGG + Intergenic
1016175085 6:141070521-141070543 CAGGTCCTTCACATGACACGTGG - Intergenic
1017607316 6:156147967-156147989 CTGGTCCTTCTGTTGAGAGCTGG - Intergenic
1018726258 6:166615513-166615535 CAGGTCCTTCCGATGTGACTGGG - Intronic
1019161249 6:170068222-170068244 CTGGACATTCAGGTCAGACGAGG + Intergenic
1019954405 7:4401951-4401973 CTGGTCCTTCCCATGACACGTGG + Intergenic
1026131594 7:67625548-67625570 CTGGTCCATCAGAGGAGGCTCGG - Intergenic
1026827078 7:73591163-73591185 CTGATCCTTCAGATGGGGCTGGG - Intergenic
1030752099 7:113241214-113241236 CTGGTCCTACCCTTGAGACGTGG - Intergenic
1031090633 7:117349542-117349564 CTGCTGCTTCAGATGAGATATGG - Intergenic
1033801569 7:144908239-144908261 CTCGCCCTTCAGATGATAAGTGG - Intergenic
1037683682 8:21119587-21119609 CTGGACCCTGAGATGAGACCCGG + Intergenic
1039014783 8:33134513-33134535 CTGGTCCTTCACATGACACGTGG + Intergenic
1039028903 8:33288123-33288145 CTGTTCCTTCAGTTGAAAAGAGG - Intergenic
1041823687 8:62067749-62067771 CTGGTCCTTCCCATGACACTTGG - Intergenic
1043938780 8:86173533-86173555 GTGATCCTTCAGAGGAGAAGAGG + Intergenic
1044317146 8:90763316-90763338 CTGGTCCTCCACATGAGATATGG - Intronic
1044418257 8:91961020-91961042 CTGCTCCTTCAGACTAGACAAGG + Intronic
1048441405 8:134462170-134462192 CTGGTGATTCAGATGAGCAGTGG - Intergenic
1049072279 8:140365360-140365382 CTGGTCCCTCACATGGCACGTGG + Intronic
1049178816 8:141209939-141209961 CTGGGCCTTCAGATGAGGGTGGG + Intronic
1051267667 9:15324151-15324173 CTGGTCCCTCCCATGAGATGTGG - Intergenic
1053193989 9:36100733-36100755 CTGGTATTTCAGAGGAGACAAGG - Intronic
1054708341 9:68485375-68485397 CTGGTCCCTCCCATGACACGTGG - Intronic
1055218052 9:73891690-73891712 CTGGTCCTTCAGATGGATCGTGG + Intergenic
1055687627 9:78794253-78794275 CTGGTCCCTCACATGACACATGG + Intergenic
1060366051 9:123014987-123015009 CGGGTCCTTCCCATGACACGTGG + Intronic
1061002517 9:127910360-127910382 CTGGTCCCTTAGATGAGGAGAGG - Intronic
1061581137 9:131537011-131537033 TTGGTGTTTCAGAAGAGACGAGG - Intergenic
1185514032 X:685220-685242 TGGGTCCTTCCGATGAAACGTGG - Intergenic
1189176705 X:38964576-38964598 CTGGTCCTGCCGTTGACACGTGG + Intergenic
1194456001 X:94104478-94104500 CAGGTCCCTCACATGAAACGTGG + Intergenic
1194766873 X:97851950-97851972 CTGGTCCTGCACTTGACACGTGG + Intergenic
1197657412 X:129132105-129132127 CTGTTGCTTCAAATGAGATGAGG + Intergenic
1199163131 X:144637942-144637964 CAGGTCCTTCCCATGACACGTGG + Intergenic
1199171097 X:144735071-144735093 CTGGTCCTGCCGTTGACACGTGG + Intergenic
1201547491 Y:15181492-15181514 CTGGTCCTTCCCATGACAGGTGG - Intergenic