ID: 1132701701

View in Genome Browser
Species Human (GRCh38)
Location 16:1224875-1224897
Sequence TTTCCTGAGCAGGACCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 311}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132701701_1132701707 3 Left 1132701701 16:1224875-1224897 CCCTCCAGGTCCTGCTCAGGAAA 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1132701707 16:1224901-1224923 ATCACCAGTGTTCTAGGGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 136
1132701701_1132701710 12 Left 1132701701 16:1224875-1224897 CCCTCCAGGTCCTGCTCAGGAAA 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1132701710 16:1224910-1224932 GTTCTAGGGCCTGGGACTCCTGG 0: 1
1: 0
2: 1
3: 24
4: 231
1132701701_1132701706 -2 Left 1132701701 16:1224875-1224897 CCCTCCAGGTCCTGCTCAGGAAA 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1132701706 16:1224896-1224918 AAGAAATCACCAGTGTTCTAGGG 0: 1
1: 0
2: 3
3: 14
4: 202
1132701701_1132701705 -3 Left 1132701701 16:1224875-1224897 CCCTCCAGGTCCTGCTCAGGAAA 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1132701705 16:1224895-1224917 AAAGAAATCACCAGTGTTCTAGG 0: 1
1: 0
2: 3
3: 30
4: 373
1132701701_1132701708 4 Left 1132701701 16:1224875-1224897 CCCTCCAGGTCCTGCTCAGGAAA 0: 1
1: 0
2: 2
3: 27
4: 311
Right 1132701708 16:1224902-1224924 TCACCAGTGTTCTAGGGCCTGGG 0: 1
1: 0
2: 2
3: 13
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132701701 Original CRISPR TTTCCTGAGCAGGACCTGGA GGG (reversed) Intronic
900158579 1:1213090-1213112 CTTCCTGAGCAGGGGCCGGATGG + Exonic
900741376 1:4332895-4332917 TTTCCTGGGCTGGATCTGTAGGG - Intergenic
900989194 1:6090304-6090326 TTCCCTGAGCCGGGCATGGATGG + Intronic
900992817 1:6105810-6105832 CTTCCTGCCCAGGACCAGGAGGG - Intronic
901004143 1:6163595-6163617 GCCCATGAGCAGGACCTGGAGGG + Intronic
901281257 1:8036994-8037016 TTTACTGAGTAGGAGATGGAGGG + Intergenic
901868981 1:12126466-12126488 TGCCCAGAGCAGCACCTGGATGG + Intronic
903415271 1:23177936-23177958 TTTCCTGAGCAGGACCGGCCGGG + Intergenic
904016430 1:27424919-27424941 ATTCCTGAGCTGGGCCTTGAAGG + Intronic
905187869 1:36209720-36209742 AGTCCTCAGCAGGGCCTGGATGG + Intergenic
905386199 1:37605992-37606014 TTTCCTGGGCCAGTCCTGGAAGG - Intergenic
906201932 1:43966075-43966097 CTTTTTGAGCAGGAGCTGGAGGG + Intronic
907370905 1:54002784-54002806 ATACCTAAGCAGGACCTTGAAGG - Intergenic
907799585 1:57751413-57751435 GCTCCTGAGCAGCAACTGGAGGG + Intronic
909561591 1:77014466-77014488 TTTCCTGGGCAGGGCCTGGGTGG - Intronic
911706640 1:101021532-101021554 GTTCCTTATCAGGACCTGGCAGG + Intronic
911899365 1:103483152-103483174 TTTTATGAGCCAGACCTGGAAGG + Intergenic
912467031 1:109881416-109881438 ACTCCTCAGCACGACCTGGATGG - Intergenic
912859198 1:113198063-113198085 TGGCCCCAGCAGGACCTGGAGGG + Intergenic
914878373 1:151529342-151529364 TGTCCGGAGCAGCTCCTGGAAGG - Exonic
915062270 1:153195938-153195960 TTTTCTGGGAAGGACCTGGGAGG - Intergenic
916040090 1:160954319-160954341 TCTGCTGTGCAGGGCCTGGAGGG - Intronic
916523509 1:165587668-165587690 TTTCTTGAGCAGGTGCTGCAGGG - Intergenic
917104897 1:171482680-171482702 TCTCCTTAGCAGCACTTGGATGG - Intergenic
918300678 1:183200836-183200858 TTTCCTAAGAAGCACCTTGAGGG + Intronic
918393970 1:184095024-184095046 TATCCAGATCAGGACCTGGAAGG + Intergenic
920110918 1:203586459-203586481 TTGGCTGAGCAGGACCAGAAGGG - Intergenic
921030090 1:211328729-211328751 TTTACTGGGGAGGACCTTGAAGG + Intronic
921116719 1:212098918-212098940 TTTCCTGGGCAGAATCTGCAGGG - Intronic
921327242 1:213998033-213998055 TTTCCAGAGAAGGAGCCGGAGGG - Exonic
922169867 1:223144902-223144924 TTTGCTGAGCAGGAACAGAAGGG + Intergenic
922750261 1:228066926-228066948 TTCCCCGAGCTGGGCCTGGATGG - Intergenic
922792600 1:228318375-228318397 GTCCCTGAGCAGGTCCTGGGTGG + Intronic
1062967743 10:1623048-1623070 TGTGCTGAGCAGGAGTTGGAAGG + Intronic
1063411638 10:5840847-5840869 TTTCTGCAGCAGGACCTGGGTGG - Intronic
1064140869 10:12789035-12789057 ATTCCTGAGCAAGAACAGGAAGG - Intronic
1064695087 10:17956932-17956954 TTTCCTGACAAAGAGCTGGAAGG - Intronic
1065695592 10:28376764-28376786 TTTCCAGGGCAGAGCCTGGAAGG - Intergenic
1067748693 10:48956065-48956087 TTCTCTAACCAGGACCTGGAGGG + Intronic
1068843309 10:61640432-61640454 TTTTATGAGCAGGGCTTGGAGGG + Intergenic
1070756882 10:78998752-78998774 TTTCCTGGGAAGCAGCTGGAGGG + Intergenic
1071423121 10:85522110-85522132 TATCCTGGGTAGGACCTGGTGGG - Intergenic
1072618673 10:97066047-97066069 TTTCCTGGGGATGGCCTGGATGG + Exonic
1073204246 10:101760324-101760346 TTTCCTGAGCAAAACCTGTATGG - Intergenic
1073399790 10:103247743-103247765 TTTCCAGAGCACGAGCTGAAGGG + Exonic
1074024619 10:109621533-109621555 TGTCCTGGGAAGGACCTGGTAGG - Intergenic
1075686736 10:124369523-124369545 TGTCCTGGGAAGGACCTGGTGGG + Intergenic
1076597922 10:131637409-131637431 TTTCCCAAGCTGGCCCTGGAGGG - Intergenic
1076696398 10:132249372-132249394 TTCCCTGAGCAGCATCTGCATGG - Intronic
1076848255 10:133080551-133080573 TTGCCTAAGCAGGACCCCGAGGG + Intronic
1077370758 11:2180556-2180578 GGTCCTGAGCAGGAGCAGGAAGG + Intergenic
1077413340 11:2413564-2413586 CTTCCTGACCAGGATCTGGTGGG - Exonic
1077756472 11:5035022-5035044 TTTTCTGAGTAGCACTTGGAAGG - Intergenic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1080567509 11:33525566-33525588 TTTCCTGAGTAGAATCTGGTCGG + Intergenic
1081914315 11:46720859-46720881 TTTGGGGAGCAGGACATGGAGGG + Intronic
1083710956 11:64548050-64548072 TGTCCTGAGCATGACCGGGGCGG + Intergenic
1083926587 11:65810826-65810848 TTTCCTGAGCAGGGCCCGGGTGG + Intergenic
1083936200 11:65871395-65871417 TCTCCTGGGCTGGCCCTGGAGGG + Intronic
1084322955 11:68383784-68383806 TTTCCTGAGGAGGAGGTGGCGGG + Intronic
1085031203 11:73271909-73271931 TTTTCTCAGCAGTGCCTGGAAGG - Intronic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1087856994 11:103104077-103104099 TTTCCAGAGCAGAAGATGGATGG + Intergenic
1088732280 11:112694001-112694023 ATTGCAGAGCAGCACCTGGAAGG + Intergenic
1089466691 11:118690309-118690331 GACCCTGAGCAGGACCTGCAGGG - Intergenic
1090208283 11:124897669-124897691 TGCCCTGAGCAGGCCTTGGATGG + Intronic
1090381119 11:126328417-126328439 TTTCCTGAGGTGCACCTGCAGGG - Intronic
1090567005 11:128005992-128006014 TTTCCTCAGCAGAAGCTGAATGG + Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091389708 12:118649-118671 TTGCCAGAGCAGGAGCTTGAGGG - Intronic
1092004475 12:5057516-5057538 TGTCCTGAACAGGACTTGTAGGG + Intergenic
1092613796 12:10198147-10198169 GTTCCTGAGCTAGACCTGGAGGG - Intergenic
1096405821 12:51343612-51343634 TTTCCTGTTCAGGGCCTGCAGGG - Intronic
1099037225 12:77603659-77603681 TTTGATGAGCAGAAGCTGGATGG + Intergenic
1101496150 12:105256201-105256223 AATCCTGAGCAGGAGGTGGAAGG - Intronic
1102487711 12:113269423-113269445 TTCCATGAGCAGGATGTGGAAGG - Intronic
1103448067 12:121007811-121007833 TTTCCTGAACAGGGCTTGGGGGG - Intronic
1103454443 12:121053807-121053829 CTTCCTGGACTGGACCTGGAGGG + Intergenic
1104745428 12:131207514-131207536 TGTCCTCGGCTGGACCTGGAAGG - Intergenic
1104788912 12:131469592-131469614 TGTCCTCGGCTGGACCTGGAAGG + Intergenic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1104982415 12:132579698-132579720 TTTCCTGTGCTGCACCTGGCAGG + Intronic
1105853629 13:24357914-24357936 GTTCCTGTTCAGGGCCTGGAAGG - Intergenic
1105951417 13:25232493-25232515 TTTCCTGAGCACCAACGGGATGG + Intergenic
1105987808 13:25586414-25586436 GTTCCTGAGAAGGGCCTGAAGGG + Intronic
1108271309 13:48762329-48762351 TCTCTTGAGCTGGACCTTGAAGG - Intergenic
1108304205 13:49114647-49114669 GAACCTGAGCAGGACCTGAATGG - Exonic
1108409303 13:50130798-50130820 TTTTCTGAGCAGCCCCGGGAGGG + Intronic
1108891508 13:55266284-55266306 TGTCATGAGAAGGACCTGGTTGG - Intergenic
1109404499 13:61879074-61879096 TTGCATCAGCATGACCTGGATGG + Intergenic
1111404596 13:87786061-87786083 ATTCCTGAGAAGGACCTGTGGGG - Intergenic
1112309151 13:98302491-98302513 TTGCCTGAGCACGCCCAGGAAGG - Intronic
1112455112 13:99553252-99553274 CTTTGTGAGCAGGACCCGGAAGG + Intronic
1112586032 13:100719654-100719676 TGTCCAGAGAAGGACCTGGTGGG + Intergenic
1114632106 14:24165718-24165740 TTGCCAGAGCAGGAGCTGCAAGG - Intronic
1114760416 14:25308166-25308188 TTTCCTGAGCAGAATCTGGGAGG + Intergenic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115979986 14:39040475-39040497 CTTCCTGAACAGGGCCAGGATGG - Intronic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1117357626 14:54940655-54940677 TTTACTGAGCAAGACTTTGAAGG - Exonic
1117953581 14:61105909-61105931 TGTCCTCAACAGGTCCTGGAGGG + Intergenic
1118482626 14:66182280-66182302 TTCCCTGAGCTGAACCTGGAGGG + Intergenic
1118838573 14:69494369-69494391 TTTCCTGGTCAGGAGCTGGATGG + Intronic
1122521063 14:102344099-102344121 CCTCCAGGGCAGGACCTGGAAGG - Intronic
1122778907 14:104135460-104135482 CGCCTTGAGCAGGACCTGGAAGG - Intergenic
1124163499 15:27296065-27296087 CTTGGTGAGCAGGACCTGGGTGG + Intronic
1124609840 15:31200941-31200963 CTTCCCCAGCAGGCCCTGGAGGG - Intergenic
1127182107 15:56432211-56432233 TTTCCTAAGAAGGATCTGGCAGG + Intronic
1127856777 15:62960075-62960097 TGGCCTGAGCAGGAGCTGTAGGG - Intergenic
1129903999 15:79173156-79173178 GTACCGGAGCTGGACCTGGAGGG - Intergenic
1130049773 15:80474189-80474211 TATCCTCAGAAGGACGTGGATGG - Intronic
1131556574 15:93404685-93404707 TTGCATCAGCATGACCTGGATGG + Intergenic
1131597547 15:93813462-93813484 TGTCCTGGGAAGCACCTGGATGG + Intergenic
1131914992 15:97255266-97255288 TTTCCTGAACTGGGCCAGGATGG - Intergenic
1132701701 16:1224875-1224897 TTTCCTGAGCAGGACCTGGAGGG - Intronic
1134614476 16:15640064-15640086 TTTCCTGAGCAGCATCTTTAGGG - Intronic
1135099657 16:19594887-19594909 TTACCTGAGCAGGTGCTTGAAGG + Intronic
1137906106 16:52323525-52323547 GGTCCTTAGCACGACCTGGAAGG - Intergenic
1141255339 16:82397033-82397055 TTTCCAGAGGAGGAAATGGATGG - Intergenic
1141371822 16:83494620-83494642 TGTCCAGAGCAGGAACTGGGTGG + Intronic
1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG + Intergenic
1141870484 16:86782125-86782147 TGTCCTGAGCTGGAGCTGCATGG + Intergenic
1142425013 16:89997528-89997550 TGTCCTGAGGAGGCCCGGGAAGG - Intergenic
1143315757 17:6032221-6032243 TTTCATGAGCTGGTCATGGAAGG - Intronic
1144699185 17:17325689-17325711 CCTCCTGAGCATGACCTGCAGGG + Intronic
1146732345 17:35204599-35204621 TATCCTGTGCATGACTTGGAGGG - Intergenic
1147968025 17:44204501-44204523 TTTCCTGCGCAGGCCTTGGCTGG - Intergenic
1148783099 17:50132533-50132555 TTTCCTGAGCAGGGCCTTGGTGG + Intergenic
1150857957 17:68771331-68771353 TTTTCTATACAGGACCTGGAAGG + Intergenic
1150896244 17:69213780-69213802 TTTCCTGAGCAGAATCGGAAGGG - Intronic
1151559580 17:74863080-74863102 GCTGCTGAGCAGGGCCTGGATGG + Exonic
1151829871 17:76543185-76543207 GCTCCTGAGCAGGACCTGGCTGG + Exonic
1151957125 17:77386004-77386026 TTTCCTGATGAGGAACAGGAAGG - Intronic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1154347270 18:13552406-13552428 CTGCCTTAGCTGGACCTGGAAGG + Intronic
1154396523 18:13995674-13995696 TTTCCTCAGCTGAATCTGGAGGG + Intergenic
1154492797 18:14934197-14934219 TCTCCTGAGCCTGGCCTGGAAGG + Intergenic
1156818227 18:41338351-41338373 TGTCATCAGCAGGACCTGGGTGG + Intergenic
1158014089 18:52763749-52763771 TTTCCAGAGCAGGAGCAGAAGGG - Intronic
1158330984 18:56361599-56361621 GTTCCTGAACTGGATCTGGAGGG - Intergenic
1158404381 18:57147801-57147823 TGTCCTGAGACGGAGCTGGAGGG - Exonic
1159282853 18:66310107-66310129 TTGCATCAGCATGACCTGGATGG - Intergenic
1159754528 18:72348101-72348123 TTTACTGTGCTGGCCCTGGAAGG + Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1161393051 19:4031330-4031352 TCTGCAGAGCAGGACGTGGAGGG + Intronic
1161422193 19:4182147-4182169 TTTCCAGAGCCGGGCCAGGACGG - Intronic
1162933037 19:13966642-13966664 TTCCCGGTACAGGACCTGGAAGG + Exonic
1163784850 19:19269766-19269788 CTTCCTGAGCAGGGGATGGAGGG + Exonic
1164157999 19:22608090-22608112 TTTGAGGAGCTGGACCTGGAGGG + Intergenic
1165373614 19:35425978-35426000 TCTCTTGAGCAGGAGCAGGATGG + Intergenic
1167006081 19:46777461-46777483 TCACCTGGGCTGGACCTGGAGGG - Intronic
1168713232 19:58513403-58513425 TGTCCTGGGCAGGAACAGGATGG - Intergenic
925299160 2:2797933-2797955 CTTCCAGTGCAGGACCTGGGAGG - Intergenic
925447845 2:3943024-3943046 CCTCCAGAACAGGACCTGGAAGG - Intergenic
926583210 2:14654944-14654966 TTTCCTGACTGGGCCCTGGAGGG + Intergenic
927878504 2:26674534-26674556 TTTCCTGGGCAGAACCAGGGGGG - Intergenic
928438759 2:31273847-31273869 CATCCTGAGCTGGGCCTGGATGG - Intergenic
930902375 2:56522990-56523012 TGGCCTGGGCAGGAGCTGGAAGG + Intergenic
931078285 2:58741063-58741085 TTTCTTGAAAAGGACCTGGAAGG + Intergenic
931431959 2:62215553-62215575 TTATCCGAGCAGAACCTGGAAGG + Intronic
931987807 2:67758253-67758275 TTCACTGAGCAGAAACTGGAGGG - Intergenic
934111486 2:88747453-88747475 TTTCCTGAGCAGAATCCGGTGGG - Intronic
934757270 2:96832840-96832862 CTTCCTGAGGCGGGCCTGGAGGG - Exonic
934765337 2:96877267-96877289 TTTCATGAGCAGTGCCAGGAAGG - Intronic
935673407 2:105574323-105574345 TTTACTCAGCAGGACCAGGAAGG + Intergenic
936090609 2:109499294-109499316 TTTGCTGAGCAGCACCGAGATGG - Intronic
936633974 2:114234576-114234598 TTTCCTGAGCAGAATCTGGAGGG - Intergenic
937257154 2:120563704-120563726 TGTCCTGAGTGGGACCTGCAGGG - Intergenic
937447347 2:121970215-121970237 TTTCCTGAGCATGGGCTGGCTGG + Intergenic
938560205 2:132465516-132465538 TTTCCTGGGGAGTCCCTGGATGG + Intronic
938566780 2:132525824-132525846 TTGCCTGAGCAGCAGCTAGATGG + Intronic
938900094 2:135792383-135792405 TTTCCTGAGCAGAATCTTGGGGG + Intronic
940974137 2:159924665-159924687 TTTCCTTAGCAGTACTTGCATGG - Intergenic
945820019 2:214652271-214652293 TTTCCTTATCAATACCTGGAGGG - Intergenic
946122376 2:217527621-217527643 TCTCCTGAGAAGGAACTGGGTGG + Intronic
948385316 2:237577242-237577264 TCTCCTGGGCGGTACCTGGAAGG + Exonic
948648886 2:239426536-239426558 ATGCCTGAGCAGAAACTGGAAGG - Intergenic
1168801717 20:647661-647683 TTACCTCAGCTGGGCCTGGATGG - Exonic
1168918660 20:1512753-1512775 GCTCCAGAGCAAGACCTGGAAGG + Intergenic
1169126691 20:3133326-3133348 TTTCCTCAGCAGGACTAGGGAGG - Intronic
1170181479 20:13535150-13535172 ATTACTGAGCAGGACTTGGTTGG + Intronic
1172103131 20:32497699-32497721 TTTCCTGGGCTGGGCCAGGAAGG - Intronic
1173326513 20:42038460-42038482 GTGTCTGAGCAGGGCCTGGAAGG + Intergenic
1173793632 20:45843758-45843780 TTTCCAGCTCAGGACCTGCACGG + Intronic
1173834193 20:46114429-46114451 TTGCCTGAGATGGACCTTGAAGG + Intergenic
1175699492 20:61126718-61126740 TGCTCTGGGCAGGACCTGGAGGG + Intergenic
1175705100 20:61170967-61170989 TCTTATGAGCAGGGCCTGGATGG - Intergenic
1176046946 20:63097643-63097665 CCTCCTAAGCAGGACGTGGAGGG - Intergenic
1177271383 21:18852784-18852806 TTTCATGGGAAGGACCTGGTGGG - Intergenic
1177544210 21:22535337-22535359 TATCCTGTGCAGGACCCAGAGGG + Intergenic
1177874100 21:26610027-26610049 CTTCCTCAGCAGGTCCTGCAGGG + Intergenic
1178041144 21:28642298-28642320 CTTCATGGGCAGGAACTGGAGGG + Intergenic
1181010185 22:20035681-20035703 TGTGCTGAGCAGGACCTGTAGGG + Intronic
1181548699 22:23622162-23622184 TGTCCTCAGAAGAACCTGGAAGG + Exonic
1181688772 22:24546676-24546698 GATCCTGAGCAGGTGCTGGAGGG - Intronic
1181809703 22:25395912-25395934 TTTCCTGAGCAGACACAGGAGGG + Intronic
1182257685 22:29050266-29050288 TGACCTCAGGAGGACCTGGAAGG + Exonic
1183587672 22:38762449-38762471 TGTCCTGGGCAGGACTTGGGTGG - Intronic
1183903266 22:41021910-41021932 TCTCCTGATCACGACCTGGCCGG + Intergenic
1184690045 22:46113397-46113419 TTTCCTGAGCAGGAAGTGAGAGG + Intronic
949095578 3:81512-81534 TTGCCTGAGAAGCACCTGGGAGG - Intergenic
950876772 3:16282612-16282634 TTACTTGAGCAGGGCCTAGAAGG + Intronic
952435616 3:33269848-33269870 TTTCCTGAGCAGAATCTGGGGGG - Intergenic
953197707 3:40750070-40750092 TTCTCTGAGAAGGGCCTGGAGGG + Intergenic
953932183 3:47010945-47010967 TCTCCTGATCAGGAACTGGGTGG - Intergenic
954317828 3:49810894-49810916 TTTCTGAATCAGGACCTGGAGGG + Intronic
955108345 3:55922666-55922688 TTCCCTGTGGGGGACCTGGAAGG - Intronic
955189518 3:56747394-56747416 TTTCCTGGGCATGACCTGAAAGG + Intronic
956840278 3:73133929-73133951 ATTCCTGGGCAGCACCAGGAAGG - Intergenic
959305834 3:104665213-104665235 TGTCCTGGGAAGGACCTGGTGGG + Intergenic
962830895 3:139139037-139139059 TTTTCTGAGCAGGAGCTGACTGG + Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
964331507 3:155608310-155608332 TTTCTTGAGCAGAATCTGGAGGG + Intronic
964816198 3:160719978-160720000 TTTCCCGGGAAGCACCTGGATGG + Intergenic
967119225 3:186367833-186367855 TAGCCTGAGCAGGACAGGGAGGG - Intergenic
967208391 3:187145058-187145080 TTGCATCAGCATGACCTGGATGG - Intronic
969544260 4:7814054-7814076 TTTCCTTAGCAGTATGTGGACGG - Intronic
970986156 4:22161115-22161137 TTTCTTGATCATGACATGGATGG - Intergenic
971017768 4:22506204-22506226 TTTCCTGTTCAGGGCCTGAAGGG - Intronic
972986729 4:44774220-44774242 TGTCCTTAGGATGACCTGGAGGG - Intergenic
974128317 4:57722227-57722249 TTTCATGATCATTACCTGGAAGG - Intergenic
975573302 4:75839312-75839334 TGTCCCGGGAAGGACCTGGAGGG - Intergenic
977664751 4:99633043-99633065 TTGCATGAGAAGCACCTGGAGGG + Intergenic
978346985 4:107781279-107781301 TTTCCTGAGGAAAATCTGGACGG + Intergenic
978848620 4:113306553-113306575 TTTATTGAGAAGAACCTGGAAGG + Intronic
980857486 4:138456601-138456623 TGTGCTGTGCAGGACATGGATGG + Intergenic
981128267 4:141132039-141132061 TTTTCCGAGGGGGACCTGGAAGG - Intronic
981695361 4:147553748-147553770 TGTCGTGGGCAGGACCTGGTGGG + Intergenic
985027701 4:185754847-185754869 TTTCATGAGGCAGACCTGGAAGG + Intronic
985183932 4:187296088-187296110 TTGCATCAGCATGACCTGGATGG - Intergenic
985767356 5:1787043-1787065 TTTCCTAGGGAGGCCCTGGAAGG + Intergenic
986000903 5:3629806-3629828 TTTCCTGAGACTGACCTAGAAGG - Intergenic
986706049 5:10455603-10455625 TATCCTGTGCAGGACAGGGATGG - Intronic
986843961 5:11731681-11731703 TTTTCTGAGATGGATCTGGAAGG - Intronic
987249915 5:16089114-16089136 TTTCCTGACCAGGAAATGCATGG + Intronic
987709871 5:21492864-21492886 TTTCCGGGGCAGGAAATGGAGGG + Intergenic
988749741 5:34181299-34181321 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
991738002 5:69644503-69644525 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
991760192 5:69911921-69911943 TTTCCGGGGCAGGAAATGGAGGG + Intergenic
991787140 5:70206179-70206201 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
991789578 5:70224229-70224251 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
991814327 5:70499339-70499361 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
991817462 5:70520631-70520653 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
991839423 5:70786972-70786994 TTTCCGGGGCAGGAAATGGAGGG + Intergenic
991879586 5:71206569-71206591 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
991882026 5:71224598-71224620 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
992150447 5:73897136-73897158 AAAACTGAGCAGGACCTGGAAGG - Intronic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
994043566 5:95284498-95284520 CTTCCAGAGCCGGGCCTGGAAGG + Exonic
994171561 5:96663183-96663205 GTGCCTGGGCAGGACCCGGAAGG + Intronic
994460537 5:100064566-100064588 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
994484686 5:100377977-100377999 TTTCCGGGGCAGGAAATGGAGGG - Intergenic
995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG + Intronic
997372218 5:133369373-133369395 TCTCCTCAGCAGGACCTGGGTGG + Intronic
999561061 5:152803436-152803458 TGTCCTGAGAGGGACCTGGTGGG - Intergenic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1000739077 5:164943127-164943149 CTTCCTGTGAAGGACCTGAATGG + Intergenic
1001687914 5:173609247-173609269 TGTCCTGAGATGGAGCTGGAGGG + Exonic
1002069790 5:176672338-176672360 TGTCCTCTGCAGGACCTGCAGGG - Intergenic
1002838978 6:889576-889598 TTTCCTGAGCACGCTCTGGTAGG - Intergenic
1003714900 6:8635423-8635445 TGTCAAGAGCAGGACCTGGTGGG + Intergenic
1004273681 6:14216656-14216678 TTTCTTTAGCAGGGACTGGATGG + Intergenic
1004596322 6:17103013-17103035 TTTCCAGAGCGAGACCTAGAGGG + Intronic
1007262717 6:40575120-40575142 GTTCCTGAGCAGGAGTTGGGAGG - Intronic
1008751577 6:54739949-54739971 TGTCATGGGCAGGACCTGGTAGG + Intergenic
1010879356 6:81149441-81149463 TTTCTTGAGCAGAATCTGGGGGG + Intergenic
1012028382 6:94027492-94027514 TCTGCTGAGCATGACCTAGAAGG - Intergenic
1012550325 6:100458985-100459007 TTTCCTGAGAAATACCTGGCGGG + Intronic
1012869768 6:104659137-104659159 TTTTCTGAGCAGGACCCAGGAGG + Intergenic
1014693994 6:124596148-124596170 TTTACTTAGCAGGACCTGCAGGG + Intronic
1014895275 6:126893181-126893203 TTGCATCAGCATGACCTGGATGG + Intergenic
1015288098 6:131508192-131508214 ATTGCTGAGCAGGACGGGGAGGG + Intergenic
1016540633 6:145159980-145160002 TTGCATCAGCATGACCTGGATGG + Intergenic
1016894482 6:149038663-149038685 TTTCCAGGGGAAGACCTGGAGGG + Intronic
1017564821 6:155672236-155672258 TATCCAGAGGAGGAGCTGGAGGG + Intergenic
1019219584 6:170463409-170463431 GTGCCTGAGCTGGACCTGGAGGG + Intergenic
1019437106 7:1028039-1028061 GTCCCCGAGCAGGCCCTGGACGG - Intronic
1019709225 7:2510763-2510785 TGTCCTGAGCTGGAGCTGGGTGG - Intergenic
1019747461 7:2708859-2708881 ATTCCTCAGGAGGAGCTGGAAGG - Intronic
1022047931 7:26638227-26638249 TGTCCTGGGAAGGACCCGGAGGG + Intronic
1022114590 7:27250978-27251000 TATTCTGAGCAGGAGCAGGAGGG + Intergenic
1022211190 7:28211259-28211281 TGTCATGGGCAGGACCTGGTGGG - Intergenic
1023277978 7:38541117-38541139 TCTTCTGAACAGGACATGGAGGG + Intronic
1026189986 7:68116884-68116906 TTTCCAAAGCAGTACCTGGTGGG - Intergenic
1026357155 7:69568368-69568390 TTACTTGAGCAGGACATGGATGG - Intergenic
1027468171 7:78540595-78540617 TTTCCTGGGCAGAATCTGGTGGG - Intronic
1031080803 7:117255232-117255254 TTTCCTGACCAGGTCCTGGCCGG - Intergenic
1031287157 7:119885183-119885205 TGTCCTGAGAGGGACCTGGTGGG - Intergenic
1031385786 7:121149210-121149232 TTTCCTGAGCAGCAGGTGCACGG + Intronic
1034110075 7:148528279-148528301 TTTCCAGAGGAGAAGCTGGACGG - Intergenic
1034302718 7:150030714-150030736 GCTCCTGAGCAGGACCTTCAAGG - Intergenic
1034803341 7:154066584-154066606 GCTCCTGAGCAGGACCTTCAAGG + Intronic
1035136473 7:156708660-156708682 TTTCTTGAGCAGAATCTGGTAGG + Intronic
1035434001 7:158844317-158844339 TTTACTAAGCCAGACCTGGAGGG + Intergenic
1035664545 8:1371307-1371329 TTTCCTGACTTGGACCTGGCTGG + Intergenic
1035673592 8:1438824-1438846 TTTCCTGAGCAGAATCTGGTTGG + Intergenic
1035956381 8:4084784-4084806 TTTGCTCAGCAGGACTTGAATGG - Intronic
1037761689 8:21745816-21745838 TTCCCTGGGCCGGGCCTGGAAGG - Intronic
1039585845 8:38706312-38706334 TGTCAAGAGCAGGACCTGGTGGG + Intergenic
1040576526 8:48656586-48656608 TCACCTGAGCAGAACGTGGAAGG - Intergenic
1041624916 8:60014652-60014674 TTTCCAGAGAGGGACCTGGTGGG - Intergenic
1042630301 8:70808648-70808670 TATCCTGTGCATGACTTGGAGGG + Intergenic
1042896870 8:73680115-73680137 TTTCCTGGGCAGAATCTGGGTGG + Intronic
1045884555 8:107079957-107079979 TGTCCTGAGAGGGACCTGGTGGG - Intergenic
1046358234 8:113116226-113116248 TGTCATGAGAAGGACCTGGTAGG + Intronic
1046819033 8:118616558-118616580 TCTCCTGAGGAGGACCCAGAGGG - Intronic
1047356807 8:124129706-124129728 TGTCCTGGGAAGCACCTGGATGG + Intergenic
1047400943 8:124546926-124546948 TCTCCTGAGCAGGCCCTGTCAGG + Intronic
1047940989 8:129827108-129827130 GTTTCTGAGCAGGTCCAGGATGG - Intergenic
1048326479 8:133443048-133443070 CTTCCTGAGCTGGGCCTGGTGGG - Intergenic
1048923698 8:139252382-139252404 TTGCCTGAGCAGGGACTGGAGGG - Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1050832755 9:10034730-10034752 TTTCCTGTGCAGGACTTTGTTGG - Intronic
1051576194 9:18618605-18618627 TTTCCTGAACCGCACTTGGACGG - Intronic
1052851459 9:33380856-33380878 TTCCCTGAGGGGGAGCTGGAGGG - Intergenic
1054822088 9:69532744-69532766 TTTCCTGAGTTGGATGTGGATGG - Intronic
1055696866 9:78894401-78894423 TTACCTGTGCAAGACATGGAAGG - Intergenic
1056064121 9:82915884-82915906 TTGCCTCAGCATGCCCTGGATGG - Intergenic
1056620173 9:88205999-88206021 TTGGCTTAGCAGAACCTGGAAGG + Intergenic
1058230400 9:102417618-102417640 TTGCATCAGCATGACCTGGATGG + Intergenic
1058459935 9:105173312-105173334 TTTCCTGGGCTGGACCTGGAGGG - Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1059085753 9:111301005-111301027 TTTCCAAAGCAGTACATGGAAGG - Intergenic
1060170704 9:121458811-121458833 TTTGCTGAGCAGGACTTGGGAGG - Intergenic
1060415319 9:123425823-123425845 ATGCCTGAGCAGGGCCTTGAAGG + Intronic
1061185057 9:129048231-129048253 GGTCATGAGCAGGACATGGAGGG + Intronic
1061710091 9:132481358-132481380 TTTAGTGGGCAGGACTTGGATGG - Intronic
1062107126 9:134761874-134761896 TCTCCTGAGCAGGTCATGCAGGG - Intronic
1187081306 X:15991414-15991436 TCTCTTGAGCAATACCTGGAAGG + Intergenic
1187640561 X:21284263-21284285 TGTCCTTGGCAGGACGTGGATGG + Intergenic
1191040074 X:56069228-56069250 TGTCCTGAGAAACACCTGGATGG + Intergenic
1192905320 X:75544750-75544772 TTTCCTGAGAAGAATCTGGGTGG - Intergenic
1193236390 X:79112839-79112861 TTTCCTCAGCTCTACCTGGAGGG + Intergenic
1193277326 X:79604686-79604708 TTTCCTGGGAAGTACCTGGGCGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1194702714 X:97134000-97134022 TTGCTTGAGCAGGAGTTGGAAGG + Intronic
1197764980 X:130054410-130054432 CTACCTGAGCTGGGCCTGGAAGG + Intronic
1198853183 X:140987473-140987495 TTTCTTGAGAAGGATCAGGAGGG + Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1202014911 Y:20393242-20393264 TGTGCAAAGCAGGACCTGGAAGG - Intergenic