ID: 1132702333

View in Genome Browser
Species Human (GRCh38)
Location 16:1227160-1227182
Sequence CACGCCCACTGGAGGTTTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132702333_1132702342 12 Left 1132702333 16:1227160-1227182 CCGCAAAACCTCCAGTGGGCGTG No data
Right 1132702342 16:1227195-1227217 TAGGGGCTCAGTGTTCCCTGGGG No data
1132702333_1132702337 -7 Left 1132702333 16:1227160-1227182 CCGCAAAACCTCCAGTGGGCGTG No data
Right 1132702337 16:1227176-1227198 GGGCGTGTGGAAGTGCTTCTAGG No data
1132702333_1132702341 11 Left 1132702333 16:1227160-1227182 CCGCAAAACCTCCAGTGGGCGTG No data
Right 1132702341 16:1227194-1227216 CTAGGGGCTCAGTGTTCCCTGGG No data
1132702333_1132702340 10 Left 1132702333 16:1227160-1227182 CCGCAAAACCTCCAGTGGGCGTG No data
Right 1132702340 16:1227193-1227215 TCTAGGGGCTCAGTGTTCCCTGG No data
1132702333_1132702343 13 Left 1132702333 16:1227160-1227182 CCGCAAAACCTCCAGTGGGCGTG No data
Right 1132702343 16:1227196-1227218 AGGGGCTCAGTGTTCCCTGGGGG No data
1132702333_1132702339 -5 Left 1132702333 16:1227160-1227182 CCGCAAAACCTCCAGTGGGCGTG No data
Right 1132702339 16:1227178-1227200 GCGTGTGGAAGTGCTTCTAGGGG No data
1132702333_1132702338 -6 Left 1132702333 16:1227160-1227182 CCGCAAAACCTCCAGTGGGCGTG No data
Right 1132702338 16:1227177-1227199 GGCGTGTGGAAGTGCTTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132702333 Original CRISPR CACGCCCACTGGAGGTTTTG CGG (reversed) Intergenic
No off target data available for this crispr