ID: 1132705992

View in Genome Browser
Species Human (GRCh38)
Location 16:1243708-1243730
Sequence CACGCCCACTGGAGGTTTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132705988_1132705992 -7 Left 1132705988 16:1243692-1243714 CCTAGAAGCACTTCCACACGCCC No data
Right 1132705992 16:1243708-1243730 CACGCCCACTGGAGGTTTTGCGG No data
1132705983_1132705992 12 Left 1132705983 16:1243673-1243695 CCCCAGGGAACACTGAGCCCCTA No data
Right 1132705992 16:1243708-1243730 CACGCCCACTGGAGGTTTTGCGG No data
1132705987_1132705992 -6 Left 1132705987 16:1243691-1243713 CCCTAGAAGCACTTCCACACGCC No data
Right 1132705992 16:1243708-1243730 CACGCCCACTGGAGGTTTTGCGG No data
1132705986_1132705992 -5 Left 1132705986 16:1243690-1243712 CCCCTAGAAGCACTTCCACACGC No data
Right 1132705992 16:1243708-1243730 CACGCCCACTGGAGGTTTTGCGG No data
1132705984_1132705992 11 Left 1132705984 16:1243674-1243696 CCCAGGGAACACTGAGCCCCTAG No data
Right 1132705992 16:1243708-1243730 CACGCCCACTGGAGGTTTTGCGG No data
1132705985_1132705992 10 Left 1132705985 16:1243675-1243697 CCAGGGAACACTGAGCCCCTAGA No data
Right 1132705992 16:1243708-1243730 CACGCCCACTGGAGGTTTTGCGG No data
1132705982_1132705992 13 Left 1132705982 16:1243672-1243694 CCCCCAGGGAACACTGAGCCCCT No data
Right 1132705992 16:1243708-1243730 CACGCCCACTGGAGGTTTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132705992 Original CRISPR CACGCCCACTGGAGGTTTTG CGG Intergenic
No off target data available for this crispr