ID: 1132710186

View in Genome Browser
Species Human (GRCh38)
Location 16:1262959-1262981
Sequence CGTCCCAGAGAATGACCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132710186_1132710196 13 Left 1132710186 16:1262959-1262981 CCACCAGGTCATTCTCTGGGACG 0: 1
1: 1
2: 1
3: 9
4: 120
Right 1132710196 16:1262995-1263017 ACCAAAGGAGGTCAGGGAGCCGG 0: 1
1: 0
2: 4
3: 31
4: 329
1132710186_1132710198 14 Left 1132710186 16:1262959-1262981 CCACCAGGTCATTCTCTGGGACG 0: 1
1: 1
2: 1
3: 9
4: 120
Right 1132710198 16:1262996-1263018 CCAAAGGAGGTCAGGGAGCCGGG 0: 1
1: 0
2: 1
3: 33
4: 349
1132710186_1132710193 1 Left 1132710186 16:1262959-1262981 CCACCAGGTCATTCTCTGGGACG 0: 1
1: 1
2: 1
3: 9
4: 120
Right 1132710193 16:1262983-1263005 GCACTGGGAACAACCAAAGGAGG 0: 1
1: 0
2: 1
3: 18
4: 187
1132710186_1132710192 -2 Left 1132710186 16:1262959-1262981 CCACCAGGTCATTCTCTGGGACG 0: 1
1: 1
2: 1
3: 9
4: 120
Right 1132710192 16:1262980-1263002 CGGGCACTGGGAACAACCAAAGG 0: 1
1: 0
2: 2
3: 9
4: 111
1132710186_1132710195 7 Left 1132710186 16:1262959-1262981 CCACCAGGTCATTCTCTGGGACG 0: 1
1: 1
2: 1
3: 9
4: 120
Right 1132710195 16:1262989-1263011 GGAACAACCAAAGGAGGTCAGGG 0: 1
1: 0
2: 2
3: 17
4: 195
1132710186_1132710194 6 Left 1132710186 16:1262959-1262981 CCACCAGGTCATTCTCTGGGACG 0: 1
1: 1
2: 1
3: 9
4: 120
Right 1132710194 16:1262988-1263010 GGGAACAACCAAAGGAGGTCAGG 0: 1
1: 0
2: 2
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132710186 Original CRISPR CGTCCCAGAGAATGACCTGG TGG (reversed) Intergenic