ID: 1132712662

View in Genome Browser
Species Human (GRCh38)
Location 16:1276447-1276469
Sequence TGGGGGGCCACAACACCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132712662_1132712675 8 Left 1132712662 16:1276447-1276469 CCTGGGGGTGTTGTGGCCCCCCA No data
Right 1132712675 16:1276478-1276500 ACCAGGTCATTCTCGGGGACGGG No data
1132712662_1132712663 -9 Left 1132712662 16:1276447-1276469 CCTGGGGGTGTTGTGGCCCCCCA No data
Right 1132712663 16:1276461-1276483 GGCCCCCCACAATGCCCACCAGG No data
1132712662_1132712671 3 Left 1132712662 16:1276447-1276469 CCTGGGGGTGTTGTGGCCCCCCA No data
Right 1132712671 16:1276473-1276495 TGCCCACCAGGTCATTCTCGGGG No data
1132712662_1132712679 27 Left 1132712662 16:1276447-1276469 CCTGGGGGTGTTGTGGCCCCCCA No data
Right 1132712679 16:1276497-1276519 CGGGAGCTGGGAACAACAGAAGG No data
1132712662_1132712670 2 Left 1132712662 16:1276447-1276469 CCTGGGGGTGTTGTGGCCCCCCA No data
Right 1132712670 16:1276472-1276494 ATGCCCACCAGGTCATTCTCGGG No data
1132712662_1132712677 14 Left 1132712662 16:1276447-1276469 CCTGGGGGTGTTGTGGCCCCCCA No data
Right 1132712677 16:1276484-1276506 TCATTCTCGGGGACGGGAGCTGG No data
1132712662_1132712669 1 Left 1132712662 16:1276447-1276469 CCTGGGGGTGTTGTGGCCCCCCA No data
Right 1132712669 16:1276471-1276493 AATGCCCACCAGGTCATTCTCGG No data
1132712662_1132712678 15 Left 1132712662 16:1276447-1276469 CCTGGGGGTGTTGTGGCCCCCCA No data
Right 1132712678 16:1276485-1276507 CATTCTCGGGGACGGGAGCTGGG No data
1132712662_1132712674 7 Left 1132712662 16:1276447-1276469 CCTGGGGGTGTTGTGGCCCCCCA No data
Right 1132712674 16:1276477-1276499 CACCAGGTCATTCTCGGGGACGG No data
1132712662_1132712680 30 Left 1132712662 16:1276447-1276469 CCTGGGGGTGTTGTGGCCCCCCA No data
Right 1132712680 16:1276500-1276522 GAGCTGGGAACAACAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132712662 Original CRISPR TGGGGGGCCACAACACCCCC AGG (reversed) Intergenic